Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA004375 Similarity: 0.973 Similarity: 0.970 Similarity: 0.969
UTR: 5HSAA004375
Gene: ANAPC10_2
MFE: -29.534
ENS: 0.972
Length: 120.
Predicted Ligands:
SAM - 10/20
TPP - 6/20
cobalamin - 1/20
 RS: URS00023290BA_1797836
MFE: -22.189
Ligand: cobalamin
Species: Deltaproteobacteria bacterium RBG_16_42_7 Cobalamin riboswitch
 RS: URS0000C14A46_1660161
MFE: -40.183
Ligand: TPP
Species: Comamonadaceae bacterium SCN 68-20 TPP riboswitch (THI element)
 RS: URS0000ABA9AA_641107
MFE: -28.922
Ligand: SAM
Species: Clostridium sp. DL-VIII SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA004375 URS00023290BA_1797836 URS0000C14A46_1660161 URS0000ABA9AA_641107
Length 120. 119. 122. 119.
Similarity - 0.973 0.970 0.969
Ensemble Norm 0.972 - - -
MFE -29.534 -22.189 -40.183 -28.922
Ligands - cobalamin TPP SAM
Gene ANAPC10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.013 3.023 3.022
Length SE - 1. 4. 1.
Lev Distance - 34. 35. 39.
UBS 6. 6. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 2. 1. 2. 2.
H 3. 4. 4. 4.
BL 1. 1. 1. 1.
BR 1. 0. 1. 0.
UN 0.333 0.445 0.180 0.185

Sequences

Field Description
UTR seq + 25 auugagcugcgacccuuguucaacgccguuggcgaagccagcugcuggaggugccgagaaucugaguuucggcaagcagccagaauauuuuaaaaATGACTACACCAAACAAGACACCTC
UTR dot + 25 .((((((……….))))))..(.((((((…)))))).)((((..(((((((((…….)))))))..))..))))……………………………….
RS 1 seq AAUUUAAUACUGUAUCCAGGUGACCCUUUAAAGAGGGUAGAAUAGGGAAGAGGGUGAAACCCCCUCACGGACCCGCCACUGUAAACGAAGACGAAAUCUGCACCUAUGCCACUGCCCCC
RS 1 dot ………(((….)))…((((((….))))))……(((..(((((.(….))))))…..)))…………………….(((….)))……….
RS 2 seq GCGCCUGCUCCGGGGUGCACGUAGGAUUAAUUUCCUGGGCGUGCUGAGAUGGCGGACCUGACCGCCGGAACCGCGAACUUGAUCUGGUUAGUACCAGCGUAAGAAGAGCUGCAAUGGAAGAG
RS 2 dot ((((((……)))))).(.(((((……))))).)((((……((((((……))))))….))))..((((..(((((….)))))..))))……………….
RS 3 seq AUCUUAUUAAGAGCGGUGGAGGGACUGGCCCUUUGAAGCCCGGCAACCUGAGAAAAUUUUUAAAAUGAAUUUUUUCGUUGGUGCUAAAUCCUGCAAGAGAAUAUCUUGAAAAAUGAGAG
RS 3 dot .((((…))))((..(((((((…..)))))))..))..(((.((((((((((((((…….)))))))))))..))))))……..(((((…..)))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table