Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA004387 Similarity: 0.954 Similarity: 0.952 Similarity: 0.952
UTR: 5HSAA004387
Gene: ANAPC11
MFE: -70.382
ENS: 0.843
Length: 177.
Predicted Ligands:
cobalamin - 14/20
lysine - 6/20

 RS: URS000231F4F5_1838280
MFE: -65.994
Ligand: cobalamin
Species: Desulfotomaculum copahuensis Cobalamin riboswitch
 RS: URS0000392635_1280
MFE: -33.807
Ligand: lysine
Species: Staphylococcus aureus Lysine riboswitch
 RS: URS0000482EB3_282458
MFE: -34.207
Ligand: lysine
Species: Staphylococcus aureus subsp. aureus MRSA252 Lysine riboswitch as predicted by Rfam
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA004387 URS000231F4F5_1838280 URS0000392635_1280 URS0000482EB3_282458
Length 177. 175. 176. 176.
Similarity - 0.954 0.952 0.952
Ensemble Norm 0.843 - - -
MFE -70.382 -65.994 -33.807 -34.207
Ligands - cobalamin lysine lysine
Gene ANAPC11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 17.006 8.002 8.002
Length SE - 4. 1. 1.
Lev Distance - 48. 59. 59.
UBS 12. 12. 10. 10.
BS 0. 0. 0. 0.
ILL 3. 1. 3. 3.
ILR 4. 2. 2. 2.
H 5. 6. 5. 5.
BL 2. 4. 2. 2.
BR 2. 4. 2. 2.
UN 0.073 0.149 0.119 0.119

Sequences

Field Description
UTR seq + 25 gugcgcacuggcgugcgagacucggcgggcgcuguugagggagucgggccgcgacuguggucguuuuuauaccuucccgcgcggacgccggcgcugccaacggaagggcggguagggcggugcgugauuagguuggcgaaggcucugcugccATGAGAACTGTGGCATCTGCAGGAT
UTR dot + 25 ((((((….))))))….((((((((…))))))))…….((((((….))))))((((((…((..((((((((..((((.((.(((((……..)))))))..)))).))))))….))..)).))))))((((((((((((…..)))))))…)))))..
RS 1 seq ACGGCCUUGUAGCCGUCAGGUGCCCCCGCAAGGGGAUAAUAGGGAAUCAGGUGUGAUACCUGAGCGGUCUCCGCCACUGUAACCGGUUAGCUGCCUUCAUUUGCCACCGCCAGGGAAGGCGUAAGGCAAGCGAUGAGCCGGGAGCCAGGAUACCUGCCUGCCGGUGCCUUGGCGC
RS 1 dot (((((……)))))…….((((….))))………..(((((((…)))))))((((…))))……..((((((.((((((((….((((.((….))…)))).)))))).))….))))))(.((((((.((((……..)))).)))))).)
RS 2 seq AUAUUUUGAUGAGGCGCAUCAAUCAUGAGUAAAGUUUAGAUUACUGUCUGCUAACAGCUAAAUUUGAAAGGGUGCGAUGCCGAAGCAAUUAUAAUAGCAGUUAUAAUUUGUUGGACUUUUUGGUUAAGAGCUGAGAGUUUGUCAUUAUUUAAAAAUAAUGGAGUGCAUCACUUGUA
RS 2 dot …..((((((…..))))))…..(((((……..)))))….(((..(((((…..(.(((((((.(((((…….(((((((((….)))))))))))))).))))))).)…..)))))..)))….(((((((….)))))))(((((…)))))…
RS 3 seq AUAUUUUGAUGAGGCGCAUCAAUCAUGAGUAAAGUUUAGAUUACUGUCUGCUAACAGCUAAAUUUGAAAGGGUGCGAUGCCGAAGCGAUUAUAAUAGCAGUUAUAAUUUGUUGGACUUUUUGGUUAAGAGCUGAGAGUUUGUCAUUAUUUAAAAAUAAUGGAGUGCAUCACUUGUA
RS 3 dot …..((((((…..))))))…..(((((……..)))))….(((..(((((…..(.(((((((.(((((…….(((((((((….)))))))))))))).))))))).)…..)))))..)))….(((((((….)))))))(((((…)))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table