Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA004833 Similarity: 0.969 Similarity: 0.966 Similarity: 0.966
UTR: 5HSAA004833
Gene: ANKRD44
MFE: -40.297
ENS: 0.837
Length: 122.
Predicted Ligands:
FMN - 6/20
TPP - 4/20
glycine - 3/20
 RS: URS0000C05594_883066
MFE: -36.153
Ligand: FMN
Species: Actinobaculum massiliense ACS-171-V-Col2 FMN riboswitch (RFN element)
 RS: URS0000C4FDA4_1509407
MFE: -30.198
Ligand: TPP
Species: Aspergillus nomius NRRL 13137 TPP riboswitch (THI element)
 RS: URS0000C6B282_316330
MFE: -48.007
Ligand: cobalamin
Species: Microbispora sp. ATCC PTA-5024 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA004833 URS0000C05594_883066 URS0000C4FDA4_1509407 URS0000C6B282_316330
Length 122. 119. 123. 122.
Similarity - 0.969 0.966 0.966
Ensemble Norm 0.837 - - -
MFE -40.297 -36.153 -30.198 -48.007
Ligands - FMN TPP cobalamin
Gene ANKRD44 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 12.002 11.005
Length SE - 9. 1. 0.
Lev Distance - 27. 37. 39.
UBS 13. 12. 14. 11.
BS 0. 0. 0. 0.
ILL 1. 3. 4. 1.
ILR 3. 3. 3. 2.
H 2. 2. 2. 3.
BL 7. 7. 6. 6.
BR 8. 7. 7. 6.
UN 0.049 0.076 0.089 0.123

Sequences

Field Description
UTR seq + 25 uuaggggaagggggcguaaccccaucuccccgguuaaaguggacggcauccaccauugguucaggcaaucuucagcggugauccagaggagauccggATGGCAGTGCTCAAACTCACCGACC
UTR dot + 25 …(((((.((((……)))).)).)))((((…((((.(((.(((((.((.((((.(((.((……..))..))).)))).))……))))).).)).)….))).))))…
RS 1 seq ACAGUGCUCCGGGGUCAGUGAAAGUCUGAACCGGCGGUGAAAGUCCGCGAACCGCGCAAGCGGUUGACGAGGUGAAAUUCCUCGACCGACGGUUAAAGUCCGGAUGGGAGGCGCACUAG
RS 1 dot ……(.((((..((((…….)))).)))).)(((…(((..(.(.(((.((.(((.((((.(((((…….)))))..)))).)))…)).))).).)..))).)))…
RS 2 seq ACGAAGGGCGAAAGCUGAGUGGAUGGGUACUGGCCGUACGAGGCAGAGUCCGGUCGUUCUGAGAUUAUACUGUCAUAACUUGAUCUAGAUAAUACUAGCGAAAGGACAUGCGUGGCAUUGAUU
RS 2 dot .((.(.(((.(..(((.(…..).)))..).))).).))(.(((..((((..(((((…(((((((.((((((…..))))..))))))).)))))))..)))).))).)……….
RS 3 seq GAGGAAGCCGGUGUGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGAGCGAUCCUCACCACGCCACUGCCCCACCGGGCGGGAAGGCCGAGGGGAGCGUCGAUCCGGGAGCCAGGAUACUC
RS 3 dot ……(((((…….)))))(((….)))..(((.(.(((((…((((.(((.((.((((.((((((….))))))…))).).)).))).)))).)))))..).)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table