Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA004840 Similarity: 0.983 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA004840
Gene: ANKRD45
MFE: -24.323
ENS: 0.870
Length: 86.
Predicted Ligands:
cyclic-di-GMP - 9/20
GMP - 7/20
zmp-ztp - 2/20
 RS: URS0000D6A901_12908
MFE: -22.932
Ligand: cyclic-di-GMP
Species: unclassified sequences Cyclic di-GMP-II riboswitch
 RS: URS0000D6CB1C_290399
MFE: -22.863
Ligand: zmp-ztp
Species: Arthrobacter sp. FB24 ZMP/ZTP riboswitch
 RS: URS0000D80275_1805401
MFE: -25.126
Ligand: cyclic-di-GMP
Species: bacterium CG2_30_37_16 Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA004840 URS0000D6A901_12908 URS0000D6CB1C_290399 URS0000D80275_1805401
Length 86. 86. 86. 87.
Similarity - 0.983 0.980 0.980
Ensemble Norm 0.870 - - -
MFE -24.323 -22.932 -22.863 -25.126
Ligands - cyclic-di-GMP zmp-ztp cyclic-di-GMP
Gene ANKRD45 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.001 18.014 2.005
Length SE - 0. 0. 1.
Lev Distance - 19. 20. 25.
UBS 7. 6. 8. 6.
BS 0. 0. 0. 0.
ILL 0. 1. 2. 0.
ILR 0. 1. 3. 0.
H 3. 3. 3. 3.
BL 3. 1. 3. 3.
BR 4. 2. 2. 3.
UN 0.198 0.163 0.081 0.126

Sequences

Field Description
UTR seq + 25 guugcgccguugcuaugguaaccgaggaggccggggcccgggugugguauuuuuggaguuaATGGAGTCAGAAGGACCTCCAGAGT
UTR dot + 25 …..(((((….)))))..(((((((.((((.(.(…).).)))).)))))))……(((((((…..))).))))….
RS 1 seq CGAAGCAGUAGAGGCUUGGAAGUUCGCCCCAAAGAUGGGCGCUUACGGGACGGACAGAGUCAGUGGCGCAACCUGCUACUUCAUAA
RS 1 dot (.((((…….)))).)..((((((((..(((…….)))..))).)))))……(((((((…..)))))))……
RS 2 seq UUAACCGGUCGCAACUGGCGUUGGAUGGCUAACCAUCAGGGAGCGGCACUGACGAAGACCACGGAUCGUACGCCUGGGCCGAGGGU
RS 2 dot ….(((((….)))))((((((.(.(((..((….)).))).)..))))))…(((.(((..((……))..)))..)))
RS 3 seq GGGUAAAGCGAAAGCUUUGACCCAUAACCUAUACGUGGUCACCUUUUAGGUUAUGGAGAGCUAGUGGUGAAACCGGUCGCAUUUUUU
RS 3 dot .(.((((((….)))))).)((((((((((……………))))))))))…((.(.((((…)))).).))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table