Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA005023 Similarity: 0.948 Similarity: 0.944 Similarity: 0.942
UTR: 5HSAA005023
Gene: ANTXR2
MFE: -50.484
ENS: 0.861
Length: 182.
Predicted Ligands:
Mn2+ - 10/20
cobalamin - 10/20

 RS: URS0000AB318E_1030157
MFE: -101.929
Ligand: Mn2+
Species: Sphingomonas sp. KC8 yybP-ykoY manganese riboswitch
 RS: URS0000DA1417_1938441
MFE: -89.196
Ligand: Mn2+
Species: Burkholderia sp. Bk yybP-ykoY manganese riboswitch
 RS: URS00023321B6_544644
MFE: -40.576
Ligand: cobalamin
Species: Butyricimonas synergistica Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA005023 URS0000AB318E_1030157 URS0000DA1417_1938441 URS00023321B6_544644
Length 182. 182. 180. 183.
Similarity - 0.948 0.944 0.942
Ensemble Norm 0.861 - - -
MFE -50.484 -101.929 -89.196 -40.576
Ligands - Mn2+ Mn2+ cobalamin
Gene ANTXR2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 35.002 33.002 13.
Length SE - 0. 4. 1.
Lev Distance - 58. 57. 72.
UBS 6. 9. 10. 9.
BS 4. 0. 0. 3.
ILL 2. 1. 2. 3.
ILR 2. 1. 2. 3.
H 3. 5. 4. 4.
BL 3. 1. 3. 3.
BR 2. 2. 2. 2.
UN 0.143 0.093 0.094 0.148

Sequences

Field Description
UTR seq + 25 agucuuggguuugugaaccacgcaugggggcuguuuuagcacagcugcuaaaauaggccaggccugcaggacauacgggucugggaguguggcaaauaacuggauugaaauuuauaauuucguacagcaacuugcggagagauuugugagcccugaaATGAGATTATCTTTCATTGTGTTTT
UTR dot + 25 (((((.(.(((((….((((((…….(((((((((((….))))))))))).(((((((((………)))))))))..)))))))))))..).)))))((((…((((((((((.(((…((((((((….))))))))..)))..)))))))))).))))……….
RS 1 seq GCGCCCGUCAUCUGGGGAGUAGCCAGCCGCCCGAACCGGGCGGGCCUUCGCGUCAACAUACUUGGUCGAGAGGCCAUGGUGCGAAGGGAGCGGGACCACCGUUCGGGCGAGACCAAUGACACCGCACCUUCGCCUUGCCGGGCGGGGGGUGUGGUGUCGUUGGAUUUUUCGCCGCCCGGCCC
RS 1 dot ((.(((……..))).))……(((((((…))))))).(((((((((((…….(((((….))))))))))))))))((((((…..)))))).((((((((((((((((((((((((((((((….))))))))).))))))))))))))…)))))))………
RS 2 seq CGCCCGGUCACUGGGGAGUAGCCUUCCUUCACGCAUUGCAUGAAGGAGAGCGCGUCAACAUACUUGACCUGACGGGUCAUGGCGCGUUCGACCGGGUCGGUUUGGCGAGACCAUUGGCGCACUGCUUCGUUCUGGUCGGACGGGUGGCGGUGCGUCAUUGGUUCGUCUUACGUCCGACCG
RS 2 dot ..(((((…)))))………(((((((.((…)).)))))))((((((((((…….((((((…))))))))))))))))…..((((((…(((((.((((.((((((((((((((((((…..))))))..)))))))))))).)))))))))……)))))).
RS 3 seq UUGUAAACGUAUUGGAAAGGUAAUGUUCUUCGUGACAUUACGAGGGAAUCCCGUGAGAAUCGGGAACUGUACCCGCAGCUGUAAGUUUCAAAACUUUAGUCUCUACUGCCACUGUCUGUACAUGGAUGGGAAGGCGACGAAAAGGAAACAAGUCAGAAAACCUGCCAACACGUAACUGUUUAU
RS 3 dot ……((((.((((..((((….(((((((((….))))))))).(((((…….))))).((((….))))(((…(((((….((((.(((……(((.((((((……))))))…))))))..)))))))))….)))…)))).)))).))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table