Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA005446 Similarity: 0.970 Similarity: 0.967 Similarity: 0.967
UTR: 5HSAA005446
Gene: AP3S1
MFE: -62.956
ENS: 0.838
Length: 141.
Predicted Ligands:
cobalamin - 14/20
TPP - 4/20
molybdenum - 1/20
 RS: URS0002323892_1415557
MFE: -56.712
Ligand: cobalamin
Species: Streptomyces sp. WM6378 Cobalamin riboswitch
 RS: URS0002321D21_1915400
MFE: -56.134
Ligand: cobalamin
Species: Streptomyces luteus Cobalamin riboswitch
 RS: URS0002312A08_1592326
MFE: -56.055
Ligand: cobalamin
Species: Actinobacteria bacterium OK006 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA005446 URS0002323892_1415557 URS0002321D21_1915400 URS0002312A08_1592326
Length 141. 141. 140. 143.
Similarity - 0.970 0.967 0.967
Ensemble Norm 0.838 - - -
MFE -62.956 -56.712 -56.134 -56.055
Ligands - cobalamin cobalamin cobalamin
Gene AP3S1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.016 2.005 10.001
Length SE - 0. 1. 4.
Lev Distance - 38. 42. 35.
UBS 10. 12. 11. 12.
BS 0. 0. 0. 0.
ILL 5. 5. 5. 3.
ILR 4. 5. 3. 5.
H 3. 3. 3. 4.
BL 2. 2. 2. 2.
BR 2. 2. 2. 2.
UN 0.135 0.007 0.064 0.112

Sequences

Field Description
UTR seq + 25 ggucgcgugcgggagggggcggguggggaaggaucgcaggcgagauuacgaggcgaggcucgcgcgcccgcccccgcccuggcccccagugcccacccggucggcccggcacagccATGATCAAGGCGATCCTAATCTTCA
UTR dot + 25 (((((…..(((.(((((((((((.(..((..((((…((……))..))))..))..).))))))))))).))))))))….(((((…((….))…))))).(((……..)))…………..
RS 1 seq GGUGUUCUCGCAGCGUGGUGGACUGCACCGGCCAGCUACGGCGGCAGCAGAGGAAGCCGGUGCGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGAAUGAUCCCCGCGAGCCAGGAACUCUCACCGCCGGUCACGUCGUA
RS 1 dot ((((…..(((..((((((((((((.((((…((..((((..(…….)..))))..))….)))).))))))).))))))))))))(((((….)))))(((((((.((……..))…)))….)))).
RS 2 seq GGUGUUCGCGGGCCGUGGUGGACUGCCGAAGCCAAUACGGCGACAGGAGAGGAAGCCGGUGCGAAUCCGGCGCGGUCCCGCCACUGUGACCGGGGAGCGGUCCCCGGGAGCCAGGAACUCUCAUCGCCGUUCUCUUCUAA
RS 2 dot ((((…((((((((((.((((.(((….(((…..(((..(…….)..)))))))))..)))).))))).)))))))))((..(((((((….)))))))..))..(((((……….)))))…….
RS 3 seq GGUCUUCCAACCCGUGGUGGACUGCCGGAGCCAAGUACGGCGACAGAAGAGGAAGCCGGUGUGAAUCCGGCGCGGUCCCGCCACUGUGACCGGGGAAGGAAACUCCCCGGGAGCCAGGAACUCUCCCCGCCGGUCUCGUCGAA
RS 3 dot ((….))…..((((((((((((((((..((….((((..(…….)..))))…))..))))))..))))).)))))…..((((((.((….))))))))(((((.((……..))…)).)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table