Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA005610 Similarity: 0.974 Similarity: 0.971 Similarity: 0.971
UTR: 5HSAA005610
Gene: APEX1
MFE: -45.022
ENS: 0.991
Length: 133.
Predicted Ligands:
TPP - 11/20
FMN - 4/20
cobalamin - 3/20
 RS: URS0000D7D351_3916
MFE: -42.438
Ligand: TPP
Species: Vigna radiata var. radiata (mung bean) TPP riboswitch (THI element)
 RS: URS0000C7352C_1734395
MFE: -30.799
Ligand: molybdenum
Species: Desulfitibacter sp. BRH_c19 Moco (molybdenum cofactor) riboswitch
 RS: URS0000C440C0_3914
MFE: -40.388
Ligand: TPP
Species: Vigna angularis (adzuki bean) TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA005610 URS0000D7D351_3916 URS0000C7352C_1734395 URS0000C440C0_3914
Length 133. 133. 134. 133.
Similarity - 0.974 0.971 0.971
Ensemble Norm 0.991 - - -
MFE -45.022 -42.438 -30.799 -40.388
Ligands - TPP molybdenum TPP
Gene APEX1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 3.006 7.
Length SE - 0. 1. 0.
Lev Distance - 34. 36. 36.
UBS 9. 8. 9. 7.
BS 1. 2. 0. 2.
ILL 2. 2. 2. 2.
ILR 1. 2. 2. 2.
H 2. 2. 1. 2.
BL 3. 3. 3. 2.
BR 3. 2. 3. 3.
UN 0.120 0.105 0.045 0.105

Sequences

Field Description
UTR seq + 25 cccacgugggggcucagcgugcacccuucuuugugcucgggcaacgcgguaaaaauauugcuucggugggugacgcgguacagcugcccaagggcguucguaacgggaATGCCGAAGCGTGGGAAAAAGGGAG
UTR dot + 25 ((((((((((((((.(.(((((((((……..((.((((….((((((….))))))))))))))))).)))).)..)))).)))…(((((((…….)))))))…)))))))……….
RS 1 seq GAGAUGCACCAGGGGUGCCUGAAUCUGUAUAAGCUCUCGCUAUCAAGAUAGGAAGCUAGCAGAUCAGGCUGAGACAGUCCCUUUGAACCUGAUCAGGGUGAUGCCUGCGCAGGGAGCGUGCAUUUUUCUCUUU
RS 1 dot (((((((((((((((((((((.((((((…((((.((.((((….)))))))))).)))))))))))…….))))))…..((((..((((……))))..))))..).)))))))))…….
RS 2 seq UAUUUUGUAUUUCUCCGAGGCUAUAUUUCCUAAGGUUAAGUUCUAUGGUAUAUAGUCCUGAGUAAAACUACUCACGGGGUAUGUCUGGAAACGGUUAUACCUCCCCAUUGGAAAGGAGAAAAGAGAUAGGUCUA
RS 2 dot ((((((…(((((((((((.(((((((((…………….((.(((((.(((((((((….)))))).))).))))))))))))….))))))))………..))))))).))))))……
RS 3 seq GAGAUGCACCAGGGGUGCCUGAAUCUGUAUAAGCUCUCGCUAUCAAGAUAGAAAGCUAGCAGAUCAGGCUGAGACAGUCCCUUUGAACCUGAUCAGGGUGAUGCCUGCGCAGGGAGCGUGCAUUUUUCUCUUU
RS 3 dot (((((((((((((((((((((.((((((…((((.((…………)).)))).)))))))))))…….))))))…..((((..((((……))))..))))..).)))))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table