Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA005614 Similarity: 0.993 Similarity: 0.992 Similarity: 0.992
UTR: 5HSAA005614
Gene: APH1B
MFE: -24.137
ENS: 0.645
Length: 57.
Predicted Ligands:
unknown - 12/20
glutamine - 8/20

 RS: URS0000C5016B_12908
MFE: -9.846
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000E607E1_1801869
MFE: -22.060
Ligand: unknown
Species: Omnitrophica WOR_2 bacterium RIFCSPLOWO2_12_FULL_51_24 nhaA-I RNA
 RS: URS0000E606C0_1801826
MFE: -18.260
Ligand: unknown
Species: Omnitrophica bacterium RIFCSPLOWO2_01_FULL_45_10 nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA005614 URS0000C5016B_12908 URS0000E607E1_1801869 URS0000E606C0_1801826
Length 57. 57. 56. 56.
Similarity - 0.993 0.992 0.992
Ensemble Norm 0.645 - - -
MFE -24.137 -9.846 -22.060 -18.260
Ligands - glutamine unknown unknown
Gene APH1B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 8. 8.
Length SE - 0. 1. 1.
Lev Distance - 8. 7. 7.
UBS 4. 3. 2. 2.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 0. 1. 0. 0.
BR 2. 1. 0. 0.
UN 0.211 0.281 0.196 0.196

Sequences

Field Description
UTR seq + 25 aacgggcccccgggucgguuuccgcgguggccATGACTGCGGCCGTGTTCTTCGGCT
UTR dot + 25 ….((((((((((……)))).)).))))……..(((((…….)))))
RS 1 seq AUCGUUCAAUCUGUUGAAUGCAGAUCGGAAGUAGGAUAAAAUCUGAAGGAACGCGGA
RS 1 dot ….(((.((((((…..)))))).)))…………((((……..))))
RS 2 seq GGGUCCGGAAAUAUUUAAAUUAUUUCCGGAGGAAUUUGAUGGUCGGGCCGCCAUCU
RS 2 dot …((((((((((…….))))))))))…….((((((……)))))).
RS 3 seq GGGUUCGGAAAUAAUUUAAGUAUUUCCGGAGGAAUUUGAUGGUCGGGCCGCCAUCU
RS 3 dot …((((((((((…….))))))))))…….((((((……)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table