Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA005791 Similarity: 0.975 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA005791
Gene: APOLD1
MFE: -38.927
ENS: 0.893
Length: 109.
Predicted Ligands:
SAM - 9/20
glycine - 5/20
tetrahydrofolate - 2/20
 RS: URS00019B5291_662548
MFE: -48.006
Ligand: glycine
Species: Variovorax sp. RA8 Glycine
 RS: URS0000D89209_1797662
MFE: -48.731
Ligand: SAM
Species: Chloroflexi bacterium RBG_16_70_13 SAM riboswitch (S box leader)
 RS: URS0000C6D1D8_207745
MFE: -47.406
Ligand: glycine
Species: Variovorax sp. WDL1 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA005791 URS00019B5291_662548 URS0000D89209_1797662 URS0000C6D1D8_207745
Length 109. 109. 110. 110.
Similarity - 0.975 0.975 0.975
Ensemble Norm 0.893 - - -
MFE -38.927 -48.006 -48.731 -47.406
Ligands - glycine SAM glycine
Gene APOLD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.001 7. 5.001
Length SE - 0. 1. 1.
Lev Distance - 32. 30. 31.
UBS 9. 7. 10. 7.
BS 0. 0. 0. 0.
ILL 4. 4. 4. 4.
ILR 3. 3. 4. 3.
H 1. 1. 1. 1.
BL 2. 2. 4. 2.
BR 4. 3. 3. 3.
UN 0.046 0.073 0.036 0.073

Sequences

Field Description
UTR seq + 25 agugugcaggcaggcgggggugcgcggggcggucagcgaucugcagcuucgcggggacagagauguaacccaacucguucacggATGTTCCGCGCGCCGTGTCACCGGC
UTR dot + 25 …..((.((..((((..(((((((((((((((.(((((………..(..((((((….)))..)))..)))))).))…))))))))))))).)))).)).))
RS 1 seq CGUUUCCUUGCUGGAGAGAGGCGGCUUUGCUUGAGUGAAGCCGCCCACCGAAGGAGCAAACCUCGAUCGUGGGGCGAAUCUCUCAGGUAAAGCGGACAGCAGGGGUGGC
RS 1 dot ….(((((((((……..(.((((((((((((.((…(((((..(((..(((…..)))..)))..)))))..)).)))))))))))).).)))))))))….
RS 2 seq GACUUAUCAAGAGUGGCGGAGGGACCGGCCCGAUGAAGCCACGACAACCUACCGGCGCGACGCCGGCAAGGUGCCAAGUCCGAGCAGGCCCUCCGCCUGCGAGAUAAGGG
RS 2 dot ..((((((..(…(((((((((.((.(((.(((…((…….((((.((((((…))))))..))))))…))).).)).)))))))))))..)..))))))..
RS 3 seq CGUUUCCUUGCUGGAGAGAGGCGGCUUUGCUUGAGUGAAGGCCGCCCACCGAAGGAGCAAACCUCGAUCGUGGGGCGAAUCUCUCAGGUAAAGCGGACAGCAGGGGUGGC
RS 3 dot ….(((((((((……..(.((((((((((((.((….(((((..(((..(((…..)))..)))..)))))..)).)))))))))))).).)))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table