Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA006140 Similarity: 0.953 Similarity: 0.952 Similarity: 0.951
UTR: 5HSAA006140
Gene: ARHGAP11B
MFE: -47.415
ENS: 0.850
Length: 170.
Predicted Ligands:
TPP - 11/20
Mg2+ - 6/20
cobalamin - 1/20
 RS: URS0000ABA47E_868595
MFE: -50.301
Ligand: Mg2+
Species: Desulfotomaculum carboxydivorans CO-1-SRB M-box riboswitch (ykoK leader)
 RS: URS0000C6119B_36816
MFE: -71.155
Ligand: cobalamin
Species: Streptomyces caelestis Cobalamin riboswitch
 RS: URS0000ABCA40_485916
MFE: -49.217
Ligand: Mg2+
Species: Desulfotomaculum acetoxidans DSM 771 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA006140 URS0000ABA47E_868595 URS0000C6119B_36816 URS0000ABCA40_485916
Length 170. 168. 170. 170.
Similarity - 0.953 0.952 0.951
Ensemble Norm 0.850 - - -
MFE -47.415 -50.301 -71.155 -49.217
Ligands - Mg2+ cobalamin Mg2+
Gene ARHGAP11B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 12. 12.001
Length SE - 4. 0. 0.
Lev Distance - 56. 57. 58.
UBS 13. 14. 16. 12.
BS 0. 0. 0. 0.
ILL 6. 6. 5. 4.
ILR 4. 5. 4. 3.
H 2. 2. 2. 3.
BL 5. 5. 6. 3.
BR 6. 6. 7. 5.
UN 0.047 0.048 0.041 0.071

Sequences

Field Description
UTR seq + 25 gggggucggggccgcagaagugccagacggggccggaaagcagccgagcggaguucaaauuugagagcguuuggaaauuggaagacuugguggcgaacgagggucaggaccugcauccugccucagaguuaucgacguauccggaATGTGGGATCAGAGGCTGGTGAAGT
UTR dot + 25 (.(((((..((((.(…..(((((..((((…………(((((((…((((….))))..)))))))………..)))).)))))…..)))))..))))).)..((.(((((.((….((.((((…….)))).)).)).))))).))……
RS 1 seq AUUUAGCUUCGUUAGGUGAGGCUUCUGCAUAGACAAAUGCCACUGCCCGGAAAUGUCGAGAGACGCUAACGGGUUAACAGGUUCUACCGGCUUAAGGUUAUACCUAAUGUGGCUGGGACAAGUGCCCUAGCUAUGUAUGUGCCAAAGCUUGCACGAGUGGAGAAGGCC
RS 1 dot .(((((((.(((((((((((.(((..((.((((…..(((…(((((..(.((((….)))).)..)))))…..)))))))…))..))).)).))))))))).)))))))……(((.(..((((…(((((……..))))).))))..).))).
RS 2 seq GGUGGCGCGACGCAAGAGGGAACCCGGUGCGAAUCCGGGGCUGUCCCGCAGCGGUGAGUGGGAACGAGAGCCGUCGAUGUCACUGGGCCCGCGUCAGGGCCGGGGAAGAGACGGCCGGUAGGUAUCCGUCGUGUUGUCGGCGGACGUGCCCGCGAGUCCGAAGACCUGCC
RS 2 dot …(((.((((((….(((..(((((((…(((.(.(((((((((((……..)))))).)…)))).).)))..))))))))))))))).).))).(((….(((.((.((((.(..(((((((……)))))))).)))).))..)))……)))…
RS 3 seq AUAAUUCCUCGUUAGGUGAGGCUUCUGCAUAGAACAUAUGCCACUGCCCGGAUAGGUCGAAAGACCGUAACGGGUUAACAGGUAUUACCGGAUUAAGGUUUUAUCUAAUGUGGCUGAGAUUUAUGUCUCUAGCUGUGCAUGUGCCAAAACUCGUACGAGUGGGGAAUGGG
RS 3 dot ……((.((((((((((((((((((..((……(((((…(((((….((((….))))….)))))…..))))))).))))….)))))))))))))).))(((((((….))))).))((.(((.(((((……..))))).))).))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table