Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA006309 Similarity: 0.970 Similarity: 0.966 Similarity: 0.966
UTR: 5HSAA006309
Gene: ARHGDIA
MFE: -42.512
ENS: 0.969
Length: 117.
Predicted Ligands:
TPP - 7/20
glycine - 4/20
SAM - 3/20
 RS: URS0000C2585C_1184607
MFE: -38.905
Ligand: TPP
Species: Austwickia chelonae NBRC 105200 TPP riboswitch (THI element)
 RS: URS0000DB6538_1123282
MFE: -29.448
Ligand: FMN
Species: Sporobacter termitidis DSM 10068 FMN riboswitch (RFN element)
 RS: URS0000DA8EFA_159291
MFE: -37.676
Ligand: TPP
Species: Spirochaeta americana TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA006309 URS0000C2585C_1184607 URS0000DB6538_1123282 URS0000DA8EFA_159291
Length 117. 116. 117. 115.
Similarity - 0.970 0.966 0.966
Ensemble Norm 0.969 - - -
MFE -42.512 -38.905 -29.448 -37.676
Ligands - TPP FMN TPP
Gene ARHGDIA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 12.001 5.001
Length SE - 1. 0. 4.
Lev Distance - 37. 40. 39.
UBS 10. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 1. 2. 3. 2.
ILR 2. 3. 3. 1.
H 4. 3. 3. 3.
BL 4. 3. 2. 4.
BR 1. 1. 2. 2.
UN 0.077 0.060 0.043 0.104

Sequences

Field Description
UTR seq + 25 gggcggccgacgacguucgucauuuagugcgggagggauccugaaccgcgcggccgaacccuccggugucccgacccaggcuaagcuugagcATGGCTGAGCAGGAGCCCACAGCCG
UTR dot + 25 (((((((((.((.((………..((.(((((….))))).))))))))))))..)))…(((……)))(((((…)))))…..(((((.((….))…))))).
RS 1 seq GGCCACGACGCGGGGUGCCGGGGCACAUCGGGGUGGAUCGUCGCCCCCCGGCUGAGAACAGACCCGUCGAACCUGCUCUAGUUCGUUCUAGCGAAGGGACGUCACCAUGUCCUCCU
RS 1 dot ((…(((((.((.(((((((……..(((((((….))))))))))))…..))…)))))))..))..(.((((……)))).)..(((((((….)))))))…
RS 2 seq UUGUGUCUUCAGGGCAGGGUGUGAUUCCCUACCGGUGGUAUAGCCCACGAGCGCCAAGGCGCAGAUUCGGUGAAAUUCCGAGGCCGACAGUUAUAGUCUGGAUGAAAGAAGAUGACA
RS 2 dot (((((((((..((((.((((…(((.((….)).)))…))))….)).)))))))))))..(((((………..)))))..(((((..(((…….)))..))))).
RS 3 seq GUAAUUUCGGAGGGGUGCUGUUGCACCGGUCUCGUUGAGACGGGCAGCGGCUGAGAUCACACCCAGAGAACCUGAUCCAGGUAAUGCUGGCGGAGGGAACAUGUCCAGAGUAAAA
RS 3 dot ((.((((((…….((((((((.((.(((((…))))))))))))))))))))).))..((((…(((((…)))))….)))).(((.(…..).)))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table