Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA006430 Similarity: 0.961 Similarity: 0.959 Similarity: 0.958
UTR: 5HSAA006430
Gene: ARHGEF17
MFE: -59.960
ENS: 0.898
Length: 160.
Predicted Ligands:
cobalamin - 8/20
FMN - 8/20
TPP - 3/20
 RS: URS0000C6DF3D_1678637
MFE: -72.914
Ligand: cobalamin
Species: Streptomyces caatingaensis Cobalamin riboswitch
 RS: URS0000D94613_335659
MFE: -60.233
Ligand: FMN
Species: Bradyrhizobium sp. S23321 FMN riboswitch (RFN element)
 RS: URS0000AB311C_1834515
MFE: -80.
Ligand: cobalamin
Species: Frankia sp. EUN1h Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA006430 URS0000C6DF3D_1678637 URS0000D94613_335659 URS0000AB311C_1834515
Length 160. 160. 160. 160.
Similarity - 0.961 0.959 0.958
Ensemble Norm 0.898 - - -
MFE -59.960 -72.914 -60.233 -80.
Ligands - cobalamin FMN cobalamin
Gene ARHGEF17 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 4. 5.001
Length SE - 0. 0. 0.
Lev Distance - 51. 54. 54.
UBS 10. 10. 11. 10.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 1.
ILR 3. 2. 2. 2.
H 5. 5. 5. 5.
BL 2. 1. 3. 2.
BR 2. 2. 3. 2.
UN 0.138 0.163 0.156 0.175

Sequences

Field Description
UTR seq + 25 acuaaguugggaggugcuggugaaaccaagcuucgaaagguuaaucagaccaaggaccaacgcuagugugaguugugagggauggacacuggugaagcuccaggcuagggugggccaagggaggcaggccugccaATGGCGGACGGGGCACCCCGGCCCC
UTR dot + 25 ……….(((((..((((…)))).)))))….((((…..))))..(((.(..(((((((((..(((……)))..)))))))))..).)))..((((.((((((((……….))))))))..))))….(((((……)))))
RS 1 seq AAGAGGGAACCCGGUGGGAAUCCGGGACUGCCCCGCAGCGGUGAGCGGGAACGACCGCCGUCAACGAGCACUGGAGCCCCGCGGCUCCGGGAAGCGACGGCCGGUAGGAACGCCCGUGCCCGCCACCCGGCACGGGACGCGCCCGCGAGUCCGAAGACCU
RS 1 dot ………(((((…….)))))…..(((((……..)))))….(((((((((…..((.((((((((….))))))))…)))))))).))).((..((((((((((……..)))))))).))..))…..(((….)))..
RS 2 seq CGAUGUUCUCAGGGCGGGGUGAAAGUCCCCACCGGCGGUAAGGGCCGAAAGGCCUAAGCCCGCGAGCGCCUUCCCCAAGGUUUCUUGCCAAGGGGAGGGGUCAGCAGAUUCGGUGCGACUCCGAAGCCGACGGUUAAAGUCCGGAUGAAAGAGAACGGUC
RS 2 dot …………((.((((…….)))).)).((((…(((((….)))))….))))…..((((((((..(((…..)))..))))))))(((.((…(((((…….))))))).)))…….(.(((…………))).)
RS 3 seq UAAGAGGGAACCCGGCGAGAGUCCGGGACUGCCCCGCAGCGGUAUGUGGGAACGACCGCCGUCAGGAGCACUGGGCGCGCGACGGCGCGCCUGGGAAGCGACGGCCAGUAGGUCCGUCGGCGCCACCGGUGCCGACGGGAGCCCACGAGUCCGAAGACCU
RS 3 dot ……….((((((….).)))))…..((((((……))))))…….((((((….((.((((((((((….))))))))))…))))))))..((.((((((((((((((…)))))))))))..))).))..(((….)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table