Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA006462 Similarity: 0.968 Similarity: 0.968 Similarity: 0.966
UTR: 5HSAA006462
Gene: ARHGEF2
MFE: -64.773
ENS: 0.890
Length: 137.
Predicted Ligands:
TPP - 13/20
cobalamin - 2/20
guanidine - 2/20
 RS: URS0000C56C2E_1432307
MFE: -44.486
Ligand: TPP
Species: Sclerotinia borealis F-4128 TPP riboswitch (THI element)
 RS: URS0000C26FB3_101091
MFE: -36.570
Ligand: TPP
Species: Choanephora infundibulifera f. cucurbitarum TPP riboswitch (THI element)
 RS: URS0000BEBD3A_195253
MFE: -34.551
Ligand: glutamine
Species: Synechococcus sp. PCC 6312 Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA006462 URS0000C56C2E_1432307 URS0000C26FB3_101091 URS0000BEBD3A_195253
Length 137. 139. 137. 136.
Similarity - 0.968 0.968 0.966
Ensemble Norm 0.890 - - -
MFE -64.773 -44.486 -36.570 -34.551
Ligands - TPP TPP glutamine
Gene ARHGEF2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.003 20.002 9.002
Length SE - 4. 0. 1.
Lev Distance - 36. 34. 40.
UBS 10. 9. 9. 10.
BS 0. 0. 0. 0.
ILL 1. 0. 2. 3.
ILR 3. 4. 4. 5.
H 3. 3. 3. 2.
BL 4. 3. 0. 4.
BR 2. 2. 1. 2.
UN 0.109 0.050 0.066 0.154

Sequences

Field Description
UTR seq + 25 gggaucccgggagggagcggagcggaccugggcuuggucgccuccaagccggcgggaccgagugcuuuaggccgcucgaaagaaaguugcuccgacccgggaaaaggagaagATGTCTCGGATCGAATCCCTCACGC
UTR dot + 25 ….(((((((..((((((((((((.((((.((((((((.((.((…..)).)))))))))).)…)))))))))……….))))))..)))))))….((((…..))))((((…))))…….
RS 1 seq ACAAGGCAUGGCGGGUGUUCCAAAUUUUAUCCGUUUUAGACUUCAAGUCGAGGGCGGAUAGAAUUUGGAUCUGAGAAUAUACCGUACAUAUGAACUUGAUCUAGAUAAUUCUAGCGAAAGGACAUGCUUCCCCUUCCCA
RS 1 dot .((((.(((((((((((((((((((((((((((((((.((((…)))).)))))))))))))))))))…….)))).))))…))))..))))..(((((….))))).(((.(((……)))..)))…
RS 2 seq AUCUGCAUCAAGGGGUGCCUUUCAAUCAUUCUCUAUCUUCUUUUGAAGAAGAAUUGGUUGUUAAACCGGCUGAGAAUUUAAACCCUCAUUUAGCGGACCAGGAUAAUGCCUGCGUCGCGAUGAUGUGAUGAUGAACU
RS 2 dot .(((((…..(((((((((((((((((((((…(((((….)))))))))).)))))..)))..)))………..)))))……))))).((((……))))((((((……))))))…….
RS 3 seq AUCGUUCAUCUCUUCCCAAGCUCUCCCGCUGUAAGUGCUUCAUUCACAAUCCAAACGGGUUAACGGGUGACAUUUAAGAAGCGGUCGAUAUUUGACGGUAGAGACGGAAGUAGGGAAUCCCCCGAAGGAACGCGCU
RS 3 dot ….(((.(((((.((((((.((..(((((.((((((..((((((..(((((….)))))…))))))))))))…)))))..))..))))..)).))))).)))….(((…..)))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table