Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA006588 Similarity: 0.988 Similarity: 0.988 Similarity: 0.987
UTR: 5HSAA006588
Gene: ARID5B
MFE: -6.880
ENS: 0.979
Length: 51.
Predicted Ligands:
unknown - 15/20
glutamine - 3/20
fluoride - 1/20
 RS: URS0000D6D32C_12908
MFE: -14.890
Ligand: unknown
Species: unclassified sequences DUF1646 RNA
 RS: URS0000D672BF_12908
MFE: -14.190
Ligand: unknown
Species: unclassified sequences DUF1646 RNA
 RS: URS000080E2F0_93929
MFE: -20.606
Ligand: fluoride
Species: Fluoride riboswitch from Thermotoga petrophila (PDB 4EN5, chain A)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA006588 URS0000D6D32C_12908 URS0000D672BF_12908 URS000080E2F0_93929
Length 51. 51. 51. 52.
Similarity - 0.988 0.988 0.987
Ensemble Norm 0.979 - - -
MFE -6.880 -14.890 -14.190 -20.606
Ligands - unknown unknown fluoride
Gene ARID5B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.019 2.019 4.001
Length SE - 0. 0. 1.
Lev Distance - 16. 16. 15.
UBS 3. 2. 2. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 1.
ILR 1. 0. 0. 1.
H 2. 2. 2. 2.
BL 0. 0. 0. 1.
BR 0. 0. 0. 1.
UN 0.176 0.314 0.314 0.154

Sequences

Field Description
UTR seq + 25 gaguucaaucaauucagaacgucgagATGGCGCCAAATCTTAAAGGCAGAC
UTR dot + 25 (((((…..)))))…..((((((((……..)))))…)))….
RS 1 seq GGUUGGACGGCUUGUGCCGUUUUCAAGAUACGUCUUCUUGGGUGGGAAGUC
RS 1 dot …..((((((….)))))).((((((…….))))))……….
RS 2 seq GGUUGGACGGCUAACGCCGUUUUCAAGAUGCGUCUUCUUGGGUGGGAAGUC
RS 2 dot …..((((((….)))))).((((((…….))))))……….
RS 3 seq GGGCGAUGAGGCCCGCCCAAACUGCCCUGAAAAGGGCUGAUGGCCUCUACUG
RS 3 dot ((((……))))(((….(.(((((….))))).)..)))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table