Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA006628 Similarity: 0.970 Similarity: 0.970 Similarity: 0.970
UTR: 5HSAA006628
Gene: ARL2
MFE: -45.059
ENS: 0.861
Length: 119.
Predicted Ligands:
TPP - 9/20
methionine - 6/20
cobalamin - 2/20
 RS: URS0000DA39E2_1930254
MFE: -50.718
Ligand: TPP
Species: Arthrobacter sp. SRS-W-1-2016 TPP riboswitch (THI element)
 RS: URS0000854839_1507971
MFE: -25.996
Ligand: TPP
Species: Vibrio sp. J2-3 TPP
 RS: URS000049101C_575788
MFE: -22.396
Ligand: TPP
Species: Vibrio splendidus LGP32 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA006628 URS0000DA39E2_1930254 URS0000854839_1507971 URS000049101C_575788
Length 119. 120. 120. 120.
Similarity - 0.970 0.970 0.970
Ensemble Norm 0.861 - - -
MFE -45.059 -50.718 -25.996 -22.396
Ligands - TPP TPP TPP
Gene ARL2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.006 5.001 5.001
Length SE - 1. 1. 1.
Lev Distance - 37. 38. 38.
UBS 8. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 6. 5. 5. 5.
ILR 4. 5. 4. 4.
H 2. 2. 3. 3.
BL 0. 1. 1. 1.
BR 0. 1. 1. 1.
UN 0.134 0.058 0.158 0.158

Sequences

Field Description
UTR seq + 25 acuaugccgucggcgagcgugauagccaacaggaaccgggagcggggucccgggacugggaagaaacggcggccgggagggggcuccggggaccATGGGGCTCCTGACCATTCTGAAGA
UTR dot + 25 …..(((((…….(((..(..((..(((…((((((……))))))..)))))..)..)))))))).((..((((((((((…….))))))))))..))……….
RS 1 seq GGCUGGUACCGCGGGAGCCGCGGCGGCGGUCACAAUCGCCGCGCGGCUGAGAGGGCUUCAGCGCCGACCGCUUGACCUGAUCCGGCUAGUACCGGCGUAGGGAAGGACUCCAUGGAAGAA
RS 1 dot .(((((..((…..((((((.((((((((….))))))))))))))…..))..))))).(((…((((..((((..((((……))))..))))..))).)….)))…..
RS 2 seq GAACACUCAUCGGGGAGCGAACCAUUCAAAUAAUGAAUGCGAGCUGAGAUCAAGCAGAUGCUUGGGACCCGUAAACCUGAACCAGAUAAUGCUGGCGUAGGAAUUGAGUUAGGAACAACC
RS 2 dot ……..(((..((..((…((((((…..))))))))..))..)))(((((….))))).(((.((….((((..((((……))))..))))…)).)))……….
RS 3 seq GAACACUCAUCGGGGAGCGAACCAUUCAAAUAAUGAAUGCGAGCUGAGAUCAAGCAGACACUUGGGACCCGUAAACCUGAACCAGAUAAUGCUGGCGUAGGAAUUGAGUUAGGAACAACC
RS 3 dot ……..(((..((..((…((((((…..))))))))..))..)))((((……)))).(((.((….((((..((((……))))..))))…)).)))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table