Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA006676 Similarity: 0.967 Similarity: 0.966 Similarity: 0.966
UTR: 5HSAA006676
Gene: ARL6IP5
MFE: -33.444
ENS: 0.952
Length: 134.
Predicted Ligands:
cobalamin - 15/20
TPP - 1/20
Mg2+ - 1/20
 RS: URS000232D911_996637
MFE: -48.426
Ligand: cobalamin
Species: Streptomyces griseoaurantiacus M045 Cobalamin riboswitch
 RS: URS0002332689_441103
MFE: -28.322
Ligand: cobalamin
Species: Tropicibacter naphthalenivorans Cobalamin riboswitch
 RS: URS0000C81DDA_1703
MFE: -38.879
Ligand: TPP
Species: Brevibacterium linens TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA006676 URS000232D911_996637 URS0002332689_441103 URS0000C81DDA_1703
Length 134. 135. 134. 134.
Similarity - 0.967 0.966 0.966
Ensemble Norm 0.952 - - -
MFE -33.444 -48.426 -28.322 -38.879
Ligands - cobalamin cobalamin TPP
Gene ARL6IP5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 10.006 6.
Length SE - 1. 0. 0.
Lev Distance - 39. 40. 43.
UBS 11. 13. 11. 12.
BS 0. 0. 0. 0.
ILL 5. 6. 3. 4.
ILR 2. 3. 4. 4.
H 1. 1. 1. 1.
BL 5. 5. 4. 5.
BR 6. 5. 5. 6.
UN 0.082 0.119 0.157 0.090

Sequences

Field Description
UTR seq + 25 aaagccgaccgagacggagccgcugucaacucuccaacucagcucagcugaucgguugccgccgccgccgccgccagauucuggaggcgaagaacgcaaagcugagaacATGGACGTTAATATCGCCCCACTCC
UTR dot + 25 ……….(((..((.(.((.(((.(((..((((……(((((((……((((………((((.((((…)))).))))……)))))))))))….)))).))).))).))).)).))).
RS 1 seq GGCACUACAUGUAUGCUCGGCACCGCUGCCGCCGCAGGGGAAUCCGGUGCGAAUCCGGAACUGUCCCGCAACGGUGAAUCCACGCGUCCGCGCGUAGGGCUGAGUCCGAGGACCUGCCGGCAGUGCGCCCGGCCG
RS 1 dot …………..(((.(((..((((((((..(((((….(((..((.((…(((..(((.(.(((.((((((….))).)))..))).))))..)))..)))).)))))))))))))))).))).)))..
RS 2 seq AUGUUGGCAGCUCGAGGCAUUCUGGCCUAUCGAUCAGACACAGGGAAAUACGGAAGCCGGUGAAAAUCCGGAACGGUCGCGCCACUGUGAUCGCGCAAGCGUAAGUCAGACACGGAUCCCUGGAAAAUACUCAU
RS 2 dot ………..((.(((.((((((((.((((((((….((((((….((.(…((((…….))))..).))….)).)))))))))…….))).))))))…..)).))).))……….
RS 3 seq GGCAAUGACAUGGGGUGCCUCAUGAGGAUCCGUUCGCACCAAGACGCUGCGCACGGAGGACACCGAGGCUGAGAGAACACCCAUCGAACCUGAUCUGGGCCAUACUAGCGAAGGGAUCGUCAUGGUUGACUUCG
RS 3 dot ………..(((((…((((((.(((((.(((((….((…..((.((.(((((….(((((.((……)).)).)))..)))..)))).))….)).))))).))))).))))))…))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table