Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA006680 Similarity: 0.979 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA006680
Gene: ARL6IP5_0
MFE: -22.378
ENS: 0.987
Length: 89.
Predicted Ligands:
TPP - 10/20
guanidine - 3/20
glycine - 2/20
RS: URS0000D95167_1915004
MFE: -18.622
Ligand: TPP
Species: Streptococcus sp. 'caviae' TPP riboswitch (THI element)
RS: URS000232C37A_1869300
MFE: -27.320
Ligand: cobalamin
Species: Desulfobacterales bacterium S5133MH16 Cobalamin riboswitch
RS: URS00021EE079_12908
MFE: -29.856
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA006680 URS0000D95167_1915004 URS000232C37A_1869300 URS00021EE079_12908
Length 89. 89. 89. 89.
Similarity - 0.979 0.979 0.979
Ensemble Norm 0.987 - - -
MFE -22.378 -18.622 -27.320 -29.856
Ligands - TPP cobalamin guanidine
Gene ARL6IP5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 4.002 7.001
Length SE - 0. 0. 0.
Lev Distance - 27. 27. 26.
UBS 8. 7. 7. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 0.
ILR 1. 1. 1. 1.
H 2. 2. 2. 2.
BL 3. 3. 4. 4.
BR 4. 3. 3. 3.
UN 0.101 0.157 0.146 0.067

Sequences

Field Description
UTR seq + 25 agcugaucgguugccgccgccgccgccgccagauucuggaggcgaagaacgcaaagcugagaacATGGACGTTAATATCGCCCCACTCC
UTR dot + 25 ….(((((((.((.((….)).)).))).)))).(((.(((((..(((((……………).))))….))))))))….
RS 1 seq AGCAAACAUUUGGGGUGCCUUUGGCUGAGAUGAUACCCAUUGAACCUGAUGCAGUUAGCACUGACGCAGGGAAAUGUCACAAUGGAUAA
RS 1 dot ……(((((.((.(……).)).)))))….((((((..((((.((((((….)))).))))))………))))))….
RS 2 seq UGUUAACGCCACUGUAUUGAAGAAUCAGUAUGGGAAGGCAGCUAAAAGGGCGGGGGAGUCAGAAGACCUGCCAUUUUGUUUGGCAUUGG
RS 2 dot …….(((.(((((((((….)))))))))…))).((((((((((.((.((.(((….))))).)).)))).))))))…..
RS 3 seq AACACACUGCCACCGGGUAGAGUAAUGCAUAAAGCAUUCGUAACAUAUCGUUAGGUCUUAGAAGAUAUGUCACGGAUGCUUUUUUGGGA
RS 3 dot …((.(((((….))))).))..(.((.(((((((((((.(((((((…………..))))))).)))))))))))..)).).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table