Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA007191 Similarity: 0.977 Similarity: 0.977 Similarity: 0.976
UTR: 5HSAA007191
Gene: ARV1
MFE: -28.395
ENS: 0.864
Length: 107.
Predicted Ligands:
glycine - 10/20
SAM - 6/20
guanidine - 3/20
 RS: URS0000D87AE1_1121919
MFE: -21.134
Ligand: glycine
Species: Geosporobacter subterraneus DSM 17957 Glycine riboswitch
 RS: URS0000DABE9F_1833852
MFE: -26.959
Ligand: glycine
Species: Desulfotomaculum ferrireducens Glycine riboswitch
 RS: URS0000C2518A_1736486
MFE: -47.726
Ligand: glycine
Species: Kitasatospora sp. Root187 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA007191 URS0000D87AE1_1121919 URS0000DABE9F_1833852 URS0000C2518A_1736486
Length 107. 106. 107. 107.
Similarity - 0.977 0.977 0.976
Ensemble Norm 0.864 - - -
MFE -28.395 -21.134 -26.959 -47.726
Ligands - glycine glycine glycine
Gene ARV1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.002 6.002 5.002
Length SE - 1. 0. 0.
Lev Distance - 27. 29. 30.
UBS 7. 8. 6. 8.
BS 0. 0. 0. 0.
ILL 5. 4. 4. 4.
ILR 2. 3. 2. 2.
H 1. 1. 1. 2.
BL 1. 2. 1. 2.
BR 3. 1. 1. 2.
UN 0.047 0.094 0.093 0.093

Sequences

Field Description
UTR seq + 25 accacggugugcugaagauaaccaucuguaacaaacugccuauuuuauuggcauuuuuaccuuccuguggguagaacggcccATGGGCAACGGCGGGCGGAGCGGCC
UTR dot + 25 …..(((..(((……..((.(((((…….(((((((……(((..((((((((……))))))))..))).)))))))…))))).))))).)))
RS 1 seq UUGAUGAAUACGGGAGAGAGUUCGUAAUGAACCGCCGAAGGAAAAAGGGACGAUGAUCCGCCAAUCACGUCGCGAAAUUCUCAGGCAAAGGGACCGUAUUUUGACA
RS 1 dot …..((((((((……..((……..(((((..((((….(.((((.((((……)))))))).)….))))..)))…))))))))))))…..
RS 2 seq AUGAUGGUUGUGGGAGAGACCUUUUAAGAGGCGCCGAAGGAGCAAAACGGUUAACCUAUGCUGCGGUAACCGCUCAAACUCUCAGGCAAAAGGACUGCAACCUGACG
RS 2 dot …..((((((((……((((((…….(((…((((…..(((((.(((……..))))))))……))))..))))))))).))))))))…..
RS 3 seq CGACCCCGCUCGGGAGAGUCCCCGCACCGUUGCACGUGGUGUCACGGGGACGCCGAAGGAGCAAACCCUCCCCGGAAUCUCUCAGGCAUCCGUACCGUGCGGGGUAG
RS 3 dot …….((((….))))((((((((.((…(((.((((((..(((((..(((..((((……)))).)))..)))))..))))))))))).))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table