Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA007205 Similarity: 0.978 Similarity: 0.978 Similarity: 0.977
UTR: 5HSAA007205
Gene: ASAH2B
MFE: -30.912
ENS: 0.890
Length: 90.
Predicted Ligands:
zmp-ztp - 16/20
GMP - 2/20
TPP - 1/20
 RS: URS0000C55DB3_1497974
MFE: -44.402
Ligand: zmp-ztp
Species: Georgenia sp. SUBG003 ZMP/ZTP riboswitch
 RS: URS0000D8F9EB_1415554
MFE: -36.856
Ligand: zmp-ztp
Species: Streptomyces sp. WM6368 ZMP/ZTP riboswitch
 RS: URS000232D69E_590998
MFE: -43.203
Ligand: zmp-ztp
Species: Cellulomonas fimi ATCC 484 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA007205 URS0000C55DB3_1497974 URS0000D8F9EB_1415554 URS000232D69E_590998
Length 90. 89. 91. 89.
Similarity - 0.978 0.978 0.977
Ensemble Norm 0.890 - - -
MFE -30.912 -44.402 -36.856 -43.203
Ligands - zmp-ztp zmp-ztp zmp-ztp
Gene ASAH2B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 3.001 6.
Length SE - 1. 1. 1.
Lev Distance - 25. 27. 27.
UBS 8. 9. 7. 9.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 1. 2. 1. 1.
H 2. 2. 2. 2.
BL 3. 4. 2. 2.
BR 4. 2. 3. 2.
UN 0. 0. 0.033 0.

Sequences

Field Description
UTR seq + 25 guggaagcggaccugaggagucgcaauugugaacagguucggugcugcggcuggggcucagcgauATGGTAGCCAACCTGAGCAGAGGTC
UTR dot + 25 ((((.(.((((((((…..((((….)))).)))))))).).))))((((…((((((.(…(((…))).)))))))…))))
RS 1 seq GACCCCGGCCGUGACUGGCGCAGGUGGAGCACACCACCGGGGAGCGGCCGGAAGUUCCCGUCGGGGCACCGCACGCCUGGGUGCCUGGG
RS 1 dot (((.((((((((..((.(.(..((((…..)))).)).))..))))))))..)))(((….(((((((.((….))))))))))))
RS 2 seq GGUACGCACGGCGACUGGCGUACGGAGAACCAACUCCGGGGGAGUCGUGCGCGCUCGACCGCAUACAGGGCCGCUCGCCUGGGCCUCGCGG
RS 2 dot (((.((((((((..((……(((((……))))).))..)))))))).)))…((((…..(((((.(……)))))).))))
RS 3 seq GGCCGCGGUCGUGACUGGCGCAGGUGGGUGCAACCACCGGGGAGCGGCCGCAGUGCCCCCGCCGAGCACCGCCCGCCUGGGUGCCUGGG
RS 3 dot ((((((((((((..((….(.(((((……))))))))..)))))))).).)))((((..(.(((((………))))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table