Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA007209 Similarity: 0.992 Similarity: 0.991 Similarity: 0.988
UTR: 5HSAA007209
Gene: ASAP1
MFE: -9.466
ENS: 0.897
Length: 53.
Predicted Ligands:
glutamine - 17/20
SAM - 2/20
unknown - 1/20
 RS: URS0000C73A20_12908
MFE: -9.065
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000D77952_335992
MFE: -7.593
Ligand: SAM
Species: metY SAM V (53-MER) from Candidatus Pelagibacter ubique HTCC1062 (PDB 6FZ0, chain A)
 RS: URS0000C0E34B_12908
MFE: -9.626
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA007209 URS0000C73A20_12908 URS0000D77952_335992 URS0000C0E34B_12908
Length 53. 52. 53. 54.
Similarity - 0.992 0.991 0.988
Ensemble Norm 0.897 - - -
MFE -9.466 -9.065 -7.593 -9.626
Ligands - glutamine SAM glutamine
Gene ASAP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0. 3.003 2.001
Length SE - 1. 0. 1.
Lev Distance - 10. 12. 14.
UBS 2. 2. 3. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 0. 0. 1. 1.
BR 0. 0. 1. 0.
UN 0.321 0.327 0.264 0.352

Sequences

Field Description
UTR seq + 25 ggucguuuucugaugugacggcugagacATGGTTTCAAATTTAAAGAGGATTA
UTR dot + 25 .((((((………))))))((((((…))))))…………….
RS 1 seq UUCGUUCAUCUAUCUAGACGGAAGUAAGGCUUUUAGCCUGAAGGAACGCAUU
RS 1 dot ((((((……….))))))….(((((…)))))………….
RS 2 seq AGGCGCAUUUGAACUGUAUUGUACGCCUUGCAUAAAGCAAAAGUACUAAAAAA
RS 2 dot .((((.((…………)).))))((((…..))))………….
RS 3 seq AUCGUUCAUCCUUUUAGAGGACGGAAGUAGGUAAUGAUACCGAAGGAACGCAUC
RS 3 dot .((((((.((……))))))))…..((((….))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table