Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA007245 Similarity: 0.985 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA007245
Gene: ASB15
MFE: -7.132
ENS: 0.910
Length: 67.
Predicted Ligands:
fluoride - 10/20
homocysteine - 5/20
cobalamin - 3/20
 RS: URS0000C7EDAB_1848039
MFE: -17.575
Ligand: homocysteine
Species: Methylobacillus sp. MM2 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000D94C48_1678012
MFE: -25.195
Ligand: fluoride
Species: Streptomyces sp. MUSC 1 Fluoride riboswitch
 RS: URS0000AB7F62_378806
MFE: -24.895
Ligand: homocysteine
Species: Stigmatella aurantiaca DW4/3-1 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA007245 URS0000C7EDAB_1848039 URS0000D94C48_1678012 URS0000AB7F62_378806
Length 67. 67. 66. 68.
Similarity - 0.985 0.983 0.983
Ensemble Norm 0.910 - - -
MFE -7.132 -17.575 -25.195 -24.895
Ligands - homocysteine fluoride homocysteine
Gene ASB15 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 1.002 2.001
Length SE - 0. 1. 1.
Lev Distance - 19. 21. 21.
UBS 5. 5. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 2. 2. 1. 2.
H 1. 1. 1. 1.
BL 3. 2. 3. 3.
BR 2. 2. 2. 3.
UN 0.075 0.119 0.121 0.103

Sequences

Field Description
UTR seq + 25 guagauuagcucaacacucgagaaucauugcagcuucaaggaATGGATACTAATGATGACCCTGATG
UTR dot + 25 ….(((((.(((.((……..(((((.(……..).)))))…….)).)))..))))).
RS 1 seq CUUACCGAGAAGCGCUGCGACGGAGUUCUCCGCCAGGCUCGGUUUCGAUGAACUGCGCUUGCCUCUA
RS 1 dot ……(((((((((((.(((.(((((……..))))).))).))…….))))))..)))..
RS 2 seq CUGGUAUCCGGCGAUGGGGCUCGCCGCCAACCGCACCCCUGGGGUGCUGAUGGCCUCUACCCGCUG
RS 2 dot ……..(((((.(((((……((((.(.((((((…)))))).).)))))))))..)))))
RS 3 seq CAACCUGAGGAGCGCUGCAACGGGGACUUCCCGCCAGGCUCAGGUUCAUGUAACGGCGCUCGCUGACU
RS 3 dot …..(.((((((((((..(((.((((((.((….))…)))))).)))..)))))))).)).)..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table