Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA007251 Similarity: 0.980 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA007251
Gene: ASB17
MFE: -10.449
ENS: 0.889
Length: 96.
Predicted Ligands:
TPP - 11/20
purine - 3/20
glycine - 2/20
 RS: URS0000DB19C9_1965562
MFE: -17.191
Ligand: purine
Species: Lachnoclostridium sp. An14 Purine riboswitch
 RS: URS0000ABBC93_159087
MFE: -24.133
Ligand: TPP
Species: Dechloromonas aromatica RCB TPP riboswitch (THI element)
 RS: URS0000ABD480_1263041
MFE: -24.964
Ligand: TPP
Species: Bacteroides coprophilus CAG:333 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA007251 URS0000DB19C9_1965562 URS0000ABBC93_159087 URS0000ABD480_1263041
Length 96. 97. 97. 96.
Similarity - 0.980 0.978 0.978
Ensemble Norm 0.889 - - -
MFE -10.449 -17.191 -24.133 -24.964
Ligands - purine TPP TPP
Gene ASB17 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.004 2. 3.001
Length SE - 1. 1. 0.
Lev Distance - 25. 28. 29.
UBS 6. 5. 6. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 1. 0. 2.
H 3. 2. 4. 3.
BL 1. 1. 1. 1.
BR 1. 2. 1. 2.
UN 0.156 0.216 0.134 0.125

Sequences

Field Description
UTR seq + 25 aaaauauguaacuggaggauuacaguaugcuuaccucugauuuuauuucuacagugcugcuauaaguaacaATGAGTAAATCTACTAAATTATGTG
UTR dot + 25 …….(((((((……..)))).)))……..((.(((((((……((((……))))…..)))))))))(((……..)))
RS 1 seq UACAUUUAUGAUGUGAGAAUAUGUAUAAAUUCACAGAACGGGUGAAUGUUUCUACCGGCUGCCAUACGAGCUGACUAUGUAUUUUCCCAGAGAGGUG
RS 1 dot …(((((((((((….)))).)))))))………(((.(((((…….(((((……..)))))……))))).)))………
RS 2 seq CCCACUCGUUAGGGGUGCCAACCGCAAAACUUGGCUGAGAAUUACCCUUCGAACCUGACCGGGUCAUGCCGUCGUAGGGAAACGAACUCUGUCGUUG
RS 2 dot (((……..)))..(((((………)))))………((((.(((…….(((……)))))).)))).(((((……))))).
RS 3 seq AGUAAAACAAAGGGGUGCCCUACCUGACGGGCUGAGAUCAUACCCUACGAACCUGAUGCGGUUAGCACCGACGAAGGGAUUGUUGCUUAUCGGCAU
RS 3 dot ………..(((((((((……..))))………)))))((((.(((..((((((….)))).))..))).))))((((….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table