Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA007256 Similarity: 0.923 Similarity: 0.920 Similarity: 0.919
UTR: 5HSAA007256
Gene: ASB3
MFE: -61.356
ENS: 0.805
Length: 239.
Predicted Ligands:
cobalamin - 19/20
glucosamine - 1/20

 RS: URS0002317C18_1895720
MFE: -69.795
Ligand: cobalamin
Species: Bacteroidia bacterium 43-41 Cobalamin riboswitch
 RS: URS0000B95FA8_1520
MFE: -51.273
Ligand: cobalamin
Species: Clostridium beijerinckii Cobalamin
 RS: URS0002312F39_1349819
MFE: -104.498
Ligand: cobalamin
Species: Aureimonas sp. AU20 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA007256 URS0002317C18_1895720 URS0000B95FA8_1520 URS0002312F39_1349819
Length 239. 238. 240. 238.
Similarity - 0.923 0.920 0.919
Ensemble Norm 0.805 - - -
MFE -61.356 -69.795 -51.273 -104.498
Ligands - cobalamin cobalamin cobalamin
Gene ASB3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.002 20. 29.005
Length SE - 1. 1. 1.
Lev Distance - 101. 94. 90.
UBS 15. 16. 13. 18.
BS 0. 0. 0. 0.
ILL 5. 5. 2. 4.
ILR 2. 3. 3. 3.
H 7. 7. 6. 7.
BL 3. 3. 5. 6.
BR 2. 3. 3. 5.
UN 0.184 0.143 0.204 0.113

Sequences

Field Description
UTR seq + 25 aagugcaccugacguuauucuacgaaagcugcuucugcagggugggaauguugggaagcaaggucuagugcgacagaauugaaaagguggagagcaggugauugcuggaucccuaaugcucagcaagggggacgcauccacauaacgugagaacgaacgaaugaaugaacgcugcauaaaagcagcuuuggcuuggggaagacuggucaaacaaATGAAGACCTTTGAAGGTTTCTGTG
UTR dot + 25 …(((.((((((((..((((((…..((((….)))).))))))))))))))..)))..(((……)))…………(((((………..(((.(..(((((..(((…))))))))..)))))))))….(((……..)))………..(((((……)))))(((((((.(…….).)))))))…….((((((….))))))…..
RS 1 seq CUUUGUAGCCGAAAUGUUGGUGUUACGUAUUCCAAAUUUGGCUUCGGAAUGCGUAAUGAAAAGGGAAUCAGGUGAAAAUCCUGAACAGACCCGCUGCUGUAAAGCCUCCCUCAACCCCUCCCAAGGAGGGGAGCAGGAUGCCGCAAAAAUCACCAAUGCCACUGUUCCUCGAAAGGAAUGGGAAGGAUUUGCGGUUCGAAGGAAAAGUCAGAAGACCUGCCACUGUUUCACAACUGUU
RS 1 dot …….(((((….)))))((((((((((((…………))))))))))))…..(((..(((((…….)))))…..)))…(((….)))…(((…(((((((…)))))))…)))..((((((..((((.(…(.(((…(((((….)))))))).).)))))))))))…..((((.((((((…..)))..))).))))………
RS 2 seq UCAAAUACUUUAAUUAUAAUAAAUGCAAACUAUAGUCUGCAUUUAAGUAAUAAGGGAAUGGAGUGAAAUUCUUCAACUACCCCAGUAACCGUGAAACUGACGAAAUCAAAGGCACAAUCUAAAAUAACAAGUCCAAUCUGUUAUUUUUUGAUUGUGUCUAACAUGCCACUGAGAAAUUGGGAAGGCUUGAAAUUAGGAUGAAGUUAAGUCGGGAUACCUUGUUUUAUACACCGAUAAUAU
RS 2 dot …………(((((..((((((((.((….)).)))))))).)))))..(((..(((((…….)))))….)))((((………))))……….((((((((((.((((((((.((……))))))))))..))))))))))..((.(((.((((….))))…))).))………………(((((………………)))))…..
RS 3 seq UAUCCUCCCGCGCUGGAUGGUCCCGCGGCGCGACAUGCGUGCGCGGGCUAAGAGGGAAUGCGAAGGGCCGACUUAAACCAAGGGCCCGGAUCGCAGCCGACCCCGCGACUGUAGAGCGGCGAGGUUUCUUCACCGGCGGUCUUUCCGCCGGAAACGCCACUGGGCCUCGCGGCCCGGGAAGGCAGGAGAGGACCCGUGACCCGCGAGCCAGGAGACCUGCCAUCCCUUGCGAAGGCGG
RS 3 dot …..((((…((…(((.((((((((((…..)))).))))))))))).)))).(((((.(((((………….)))))…)))))…((((.(((..((….))..))).))))……(((((((…..)))))))……….(((((….)))))((((.((((((…((.(.((((…)))).)))……)))))).)))).(((….))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table