Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA007257 Similarity: 0.934 Similarity: 0.932 Similarity: 0.917
UTR: 5HSAA007257
Gene: ASB3_0
MFE: -94.427
ENS: 0.951
Length: 227.
Predicted Ligands:
cobalamin - 17/20
glucosamine - 2/20
lysine - 1/20
 RS: URS000049975C_1196322
MFE: -57.703
Ligand: glucosamine
Species: Clostridium sp. Maddingley MBC34-26 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0002314A83_1398085
MFE: -92.682
Ligand: cobalamin
Species: Inquilinus limosus MP06 Cobalamin riboswitch
 RS: URS000231E3D6_1797322
MFE: -69.972
Ligand: cobalamin
Species: Bacteroidetes bacterium GWB2_41_8 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA007257 URS000049975C_1196322 URS0002314A83_1398085 URS000231E3D6_1797322
Length 227. 227. 227. 228.
Similarity - 0.934 0.932 0.917
Ensemble Norm 0.951 - - -
MFE -94.427 -57.703 -92.682 -69.972
Ligands - glucosamine cobalamin cobalamin
Gene ASB3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 27. 29. 7.
Length SE - 0. 0. 1.
Lev Distance - 78. 79. 107.
UBS 9. 11. 10. 10.
BS 5. 2. 8. 6.
ILL 2. 4. 3. 2.
ILR 3. 3. 4. 3.
H 4. 5. 4. 4.
BL 5. 2. 4. 7.
BR 1. 1. 5. 2.
UN 0.141 0.163 0.145 0.136

Sequences

Field Description
UTR seq + 25 auaucaacauccgggggucgcggagccguccgccuacgggggccgggacgucgccugcgcgucucucguuuucggacggcugcagcaucgcgguggggaucgaaagcgggggcuucugggacgcagcucuggagacgcggccucggaccagccauuucgguguagaaguggcagcacggcagagacgacacuggucaaacaaATGAAGACCTTTGAAGGTTTCTGTG
UTR dot + 25 ………((((.(((((((((((((((((…..((((((((.(((((.((….)))))))(((((((((((.(.(((((……))))).)…))))))))))))))))))))))))..))))……))))))))))))…((((((((……))))))))……((((((((..((..((((………..))))..))…)))))))).
RS 1 seq UUUUGAAAAAAAGCGCCAGGACUAAGUGAAAAAGGAGGUUAAUUAGCUGAAGCUAAUUAACUAAGUUCGACUAACCAAAUCAUAGAUUUGGAGUCUCACUUAUCACUUAAGUUGACGAGGUUGGGGAGUAUCGAAACUUCGGCGGGUGCCCCACGGUAUCGCACUACCGUAAACGACUGGUAAAACUGUAAAGCGAUUUGCAGCACAAAUUCAGUCUGGUGUUAAAA
RS 1 dot ……………….((((((((((……..((((((((((….))))))))))(((((..((((..(((((((…)))))))))))..)))))))))))).)))..(((((((.((…..))..)))))))((.((((((….))))))))..(((((…..((((((…..(((((((….)))))))…….)))))))))))……
RS 2 seq GAUACACAUCCCGGCGACGGUUCCCGCACGGGAUCAAAAGGGAACACGGUGGCGCUCUCUCCAAUCGAGUGGAGGGGCGGAAUCCGUGGCUGCCCCCGCAACUGUCAGCGGAUCGCCGAACGUCACGGGCCCCUCAAGGGCCAGGCCACUGCCCGAUGCCGGGCGGGAAGGCCGACGCCAAGCCAUGAUCCGUGAGCCAGGAGACCUGCCGUCGCAGCGCAAUCCGU
RS 2 dot …………((((.((((((((((.(((.(((….(((….(((((((((((((((…..)))..(((((((…..(((((((.((..((((……..))))…))…..)))))))))))))).)))))…))))))))))))).))).))))))..)))).))))..((((((…)))).))..((((..((((….))))..)..)))..
RS 3 seq CAUUGCAGCCGUGUUGCCGGUUUCCGUUCAUUCGGAACUAAGAGGGAAUCCUGUUCAAUGCAGGAGCUGUCCCCGCAGCUGUAAACUCAAAGCCCCUCCAACUCCCCAAAAGGGAGGGCUGGGACAAAUUUUCGAACAAUAUUUUGCCACUGUUCCUUUUAACCGGGAUGGGAAGGCAGUUCGAAAAUCCGAGUGAGCCAGAAGACCUGCCUGCAACGAGAAGCUUUC
RS 3 dot ……((((.((((((.((((((.((((((((((……(.((((.((((((…..))))))….)))))…(((……….)))(((.((..(((((…..)))))))..)))….((((((((((…….((((.(((((((……..)))))))…))))))))))))))))))))))))..)))…..))).)))))).)..)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table