Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA007258 Similarity: 0.922 Similarity: 0.915 Similarity: 0.913
UTR: 5HSAA007258
Gene: ASB3_1
MFE: -88.794
ENS: 0.889
Length: 231.
Predicted Ligands:
cobalamin - 18/20
lysine - 1/20
FMN - 1/20
 RS: URS000232B27E_36856
MFE: -82.410
Ligand: cobalamin
Species: Sinorhizobium saheli Cobalamin riboswitch
 RS: URS000232B00F_765911
MFE: -69.332
Ligand: cobalamin
Species: Thiocystis violascens DSM 198 Cobalamin riboswitch
 RS: URS000231A3E7_1536774
MFE: -77.602
Ligand: cobalamin
Species: Paenibacillus sp. FSL H7-0357 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA007258 URS000232B27E_36856 URS000232B00F_765911 URS000231A3E7_1536774
Length 231. 231. 232. 232.
Similarity - 0.922 0.915 0.913
Ensemble Norm 0.889 - - -
MFE -88.794 -82.410 -69.332 -77.602
Ligands - cobalamin cobalamin cobalamin
Gene ASB3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 28. 12.002 21.
Length SE - 0. 1. 1.
Lev Distance - 91. 107. 105.
UBS 11. 12. 12. 14.
BS 5. 8. 5. 6.
ILL 1. 3. 1. 3.
ILR 2. 5. 5. 3.
H 4. 4. 3. 5.
BL 8. 9. 7. 6.
BR 4. 6. 4. 5.
UN 0.130 0.130 0.172 0.138

Sequences

Field Description
UTR seq + 25 agacgacauaucaacauccgggggucgcggagccguccgccuacgggggccgggacgucgccugcgcgucucucguuuucggacggcugcagcaucgcgguggggaucgaaagcgggggcuucugggacgcagcucuggagacgcggccucggaccagccauuucgguguagaaguggcagcacggcaggucgacuggucaaacaaATGAAGACCTTTGAAGGTTTCTGTG
UTR dot + 25 …………….(((.((((((((((((((((((…..((((((((.(((((.((….)))))))(((((((((((.(.(((((……))))).)…))))))))))))))))))))))))..))))……)))))))))))).(.((((((((……)))))))).)(((((.((.((((..((((………..)))).))))…)).)))))
RS 1 seq UUAUUAUCUGGCGCCGACGGUUCCCCGACCAAGAGGCGGAGGGGAUUAAUAGGGAACACGGUGAGGACGACCCAUAAGGGACCAAGCCCGUGGCUGCCCCCGCAACUGUAAGCGGAUUGCCGUCCAUCCUCGUGGCGCCGACGGCGCCAUGCCACUGUGCUUCGGCAUGGGAAGGCAGAUGGACGGCGUUCAUCCGCGAGCCAGGAGACCUGCCGUCACGCAUCGAUCCAU
RS 1 dot ……..((((((((.(((…..((.(((.((((.(((.((.(……(((..((((((..((….(((….))).))..))).)))….)))((((……..))))..).)).)))..)))).)))))))).))))))))((((.(((((……)))))…))))(((((((((((.((.(((……..)))))..)))))))…))))…….
RS 2 seq UAACAUCAAUCCAGUUAUGGUUCCUGGGGUCGUCAUUCUGACUCGGGAUUAAAAGGGAACACGGUGAGGUACGAGACAUCUCGACUAAUUCCGUGACUGUCCCCGCAACUGUAAACGCAUAGGCACGUCAAUAGACCACUGGGUUCGAUCCGUUCGAGUGAUCGAUGCCUGGGAAGGUUGACGAAGCUGUUGACGCGUGAGUCAGGAGACCUGCCAUACAGAUUCCAACCAC
RS 2 dot ……………..((((…((((((((((.((((((((((.(…….((((.(((((.(.(((.((((….)))))))..).)))))….)))).((…(((….)))…)).((((((((((((.(((((((((((((……).)))))).))))))…)))……..)))))))))).)))))))))))))……….))))))))))).
RS 3 seq CAAAAUAUAGUGGAAACAGGUGUUUCGCUCUUUCAUAGGGAGCUGAAGCUUAAUAGGGAAACGCGGUGCAAAUCCGCUGUGGUCCCGCCACUGUAACCGGAUGCCUGCAGGCUCUCUGAAGCCCGCGAAGCAGCGUCUACCGGCAAUAGCCACUGAGGGGCGGUAAAGCUCUCGGGAAGGCGCCGGAAGAUUCACCGGAAGCCAGGAGACCUGCCUGUUUCGCCGACACCAU
RS 3 dot …………(((((….)))))(((((((…)))))))….((((..((((((..(((((.(((..(((((.(((((…))))).)….))))))))))).)..))))))))))(.((((((((((((((.(((((….(((.((((.((((……))))))))…))).((((……..))))..))).))))))..)).)))))))).)…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table