Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA007447 Similarity: 0.984 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA007447
Gene: ASCL3
MFE: -15.018
ENS: 0.801
Length: 85.
Predicted Ligands:
zmp-ztp - 8/20
GMP - 4/20
glycine - 4/20
RS: URS0000D699DF_12908
MFE: -33.920
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
RS: URS0000D8972E_1317121
MFE: -26.392
Ligand: glycine
Species: Aestuariivita atlantica Glycine riboswitch
RS: URS0000D69854_12908
MFE: -35.145
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA007447 URS0000D699DF_12908 URS0000D8972E_1317121 URS0000D69854_12908
Length 85. 85. 85. 85.
Similarity - 0.984 0.980 0.979
Ensemble Norm 0.801 - - -
MFE -15.018 -33.920 -26.392 -35.145
Ligands - GMP glycine GMP
Gene ASCL3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.009 3.001 11.001
Length SE - 0. 0. 0.
Lev Distance - 20. 26. 24.
UBS 6. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 2.
ILR 2. 2. 2. 4.
H 2. 2. 1. 2.
BL 1. 1. 2. 3.
BR 0. 2. 1. 1.
UN 0.094 0. 0.071 0.059

Sequences

Field Description
UTR seq + 25 uuaaguccaacucagcccaaaauacagcauccugacgacaaaacucagguuaaagaggaaATGATGGACAACAGAGGCAACTCTA
UTR dot + 25 ….(((((..(((..((…………(((((.(……))))))…….))…))))))))…((((….)))).
RS 1 seq UCGCCAGCGGGAGGCUAUGACACGCGGCCCAUACUCUGGCCGCCCGGACCGCGCCGAGCCACUGGCGAGACCGACCCGUUGGAUC
RS 1 dot (((((((.((..(((……..((((((……..))))))………)))…)).)))))))((((((….)))).))
RS 2 seq CUCGUUGGAACGGGAGAAGGGCAGCCGCCCUGCCGAAGGAGCAACCGCCCCGGAAACUCUCAGGCCCAAGGACCGAUCCGACACG
RS 2 dot …((((((.(((…..((((……….(((..((.((….)))))))……….))))…..))).))))))…
RS 3 seq UCGUGCGUGGGCGGCUUGGACACGCGGCCCAAACACUGGCCGCCGGGACCGCGCCGAGCUACUGGCGAGACCGACCUGCGUUGAU
RS 3 dot ((((..((((.((((.(((.(..((((((……..))))))..)..))).))))..))))..))))…((((….))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table