Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA007457 Similarity: 0.982 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA007457
Gene: ASH2L
MFE: -19.997
ENS: 0.635
Length: 83.
Predicted Ligands:
zmp-ztp - 9/20
GMP - 5/20
cyclic-di-GMP - 2/20
 RS: URS0000AB15C3_546414
MFE: -27.497
Ligand: cyclic-di-GMP
Species: Deinococcus deserti VCD115 Cyclic di-GMP-II riboswitch
 RS: URS000231FF35_560556
MFE: -33.203
Ligand: zmp-ztp
Species: Asanoa sp. 210121 ZMP/ZTP riboswitch
 RS: URS0000C33CE0_1348253
MFE: -32.462
Ligand: zmp-ztp
Species: Microbacterium mangrovi ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA007457 URS0000AB15C3_546414 URS000231FF35_560556 URS0000C33CE0_1348253
Length 83. 83. 82. 84.
Similarity - 0.982 0.979 0.978
Ensemble Norm 0.635 - - -
MFE -19.997 -27.497 -33.203 -32.462
Ligands - cyclic-di-GMP zmp-ztp zmp-ztp
Gene ASH2L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.002 10. 5.004
Length SE - 0. 1. 1.
Lev Distance - 23. 22. 26.
UBS 9. 8. 8. 10.
BS 0. 0. 0. 0.
ILL 1. 0. 2. 1.
ILR 3. 2. 1. 1.
H 2. 2. 2. 2.
BL 6. 5. 4. 6.
BR 4. 4. 4. 4.
UN 0.012 0.060 0. 0.071

Sequences

Field Description
UTR seq + 25 cacagcaacgcgcgcgagagaagagaguauucucgcgagaaguccagggguggccgugATGACCAACTACAGTTTTCATTGCA
UTR dot + 25 (((..(.((.(.((((((((.(…..).)))))))).)..))…)..)))((.((((.(((……..))).)))).)).
RS 1 seq CUGAUGGGGAGCGCGAAGAGCCCUGUUCUGUAUUCGGGCACCUGGGACAGGGGGAGCUAGUGGUGCGACCGGCUUUUCGUCUG
RS 1 dot (((.(.(((.((.((((((((…)))))….))).)).))).)..)))((((((((.((……)).))))))))…..
RS 2 seq GGGGGUGAGUGCGACUGGCGGCACGGGAUGGCAGUGACCAUCGGGGAGCCCGCCGUGGGUAUCGACCGCCUGGGUGCCCACG
RS 2 dot (.((((…(.(((.(((…(((.(…..).))).)))))).)..)))).)((((((((((………))))))))))
RS 3 seq UCGUCGUGUCGCGACUGGCGUUGAGGUGGCUUACCACCGGGGAGCGACCGACACGGCAUUCGACCGCACGCCUGGGCCGAAGCG
RS 3 dot ..((((.(((((..((((.(.((((….)))).).))).)..)))))))))…((.((((.((.((….)))).)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table