Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA007460 Similarity: 0.980 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA007460
Gene: ASH2L_0
MFE: -18.778
ENS: 0.726
Length: 76.
Predicted Ligands:
fluoride - 7/20
cobalamin - 6/20
glutamine - 2/20
 RS: URS0000C5C846_12908
MFE: -20.388
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000DAFD26_1895740
MFE: -33.193
Ligand: fluoride
Species: Cellulomonas sp. 73-92 Fluoride riboswitch
 RS: URS0000D9429B_1752398
MFE: -19.
Ligand: fluoride
Species: Ensifer sp. YIC4027 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA007460 URS0000C5C846_12908 URS0000DAFD26_1895740 URS0000D9429B_1752398
Length 76. 74. 75. 76.
Similarity - 0.980 0.979 0.979
Ensemble Norm 0.726 - - -
MFE -18.778 -20.388 -33.193 -19.
Ligands - glutamine fluoride fluoride
Gene ASH2L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.002 8.006 2.
Length SE - 4. 1. 0.
Lev Distance - 21. 24. 28.
UBS 7. 6. 5. 7.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 0.
ILR 1. 2. 0. 1.
H 3. 2. 2. 3.
BL 3. 3. 3. 2.
BR 3. 2. 2. 3.
UN 0.039 0.081 0.120 0.053

Sequences

Field Description
UTR seq + 25 acgcgcgcgagagaagagaguauucucgcgagaaguccagggguggccgugATGACCAACTACAGTTTTCATTGCA
UTR dot + 25 ((.(.((((((((.(…..).)))))))).)..))(((….)))..(((((((..(((….))).))))))).
RS 1 seq GUCGUUCAUCUCUUUUAGAGAUCUCUUUAAAGGAGACGGAAGUAAGAGACAUAGUGUCCCUGAAGGAACGCGUG
RS 1 dot (((.(((.((((((((((((….))))))))))))..))…..).)))…((((.((….)).))))…
RS 2 seq GUCGCCGUCGGCGAUGGAUCCCGCCCGCGUCGAUGACGACGGAACCGCCGGCCGGCUGAUGGUUCCUGCUCCCAG
RS 2 dot ((((.((((((((.(((…….))))))))))).))))(((((((.(((….))).)))))))………
RS 3 seq UGGCACGUUGGCAAUGGAUUCUGCCAGGCAUCGAGCCGAACCGCUUCCCCACGAAGCUGAUGACUCCUGCUCAUGA
RS 3 dot ((((.((((((((……..))))))….)).))))….(((((…..)))))(.(((((….).)))).)

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table