Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA007584 Similarity: 0.977 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA007584
Gene: ASPH
MFE: -24.229
ENS: 0.688
Length: 97.
Predicted Ligands:
TPP - 10/20
glycine - 10/20

 RS: URS0000BE52F5_1348657
MFE: -29.049
Ligand: TPP
Species: Thauera terpenica 58Eu TPP riboswitch (THI element)
 RS: URS0000C2EEF3_1406431
MFE: -31.942
Ligand: glycine
Species: Massilia sp. WF1 Glycine riboswitch
 RS: URS0000C6FDF9_1121290
MFE: -20.398
Ligand: glycine
Species: Clostridium acetireducens DSM 10703 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA007584 URS0000BE52F5_1348657 URS0000C2EEF3_1406431 URS0000C6FDF9_1121290
Length 97. 96. 96. 96.
Similarity - 0.977 0.976 0.976
Ensemble Norm 0.688 - - -
MFE -24.229 -29.049 -31.942 -20.398
Ligands - TPP glycine glycine
Gene ASPH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.003 7.001 2.
Length SE - 1. 1. 1.
Lev Distance - 28. 28. 30.
UBS 7. 7. 8. 7.
BS 0. 0. 0. 0.
ILL 3. 1. 3. 3.
ILR 3. 2. 4. 4.
H 3. 3. 1. 2.
BL 1. 2. 1. 1.
BR 1. 1. 2. 1.
UN 0.062 0.115 0.031 0.042

Sequences

Field Description
UTR seq + 25 cccgcgucgcguguguacccccgcgcacugaaggagguccaccagcccucaccagcccccgcggaccgugcaATGGCCCAGCGTAAGAATGCCAAGA
UTR dot + 25 ..((((…))))(((((..(((((..(((…((((.(…..).))))..)))….)))))…))))).((((………….))))…
RS 1 seq CCUUCUCGUUAGGGGUGCCCGCUGCGUACGGGCUGAGAAACACCCUUGGAACCUGAUCCGGCUCGCACCGGCGUAGGGAAACGUCACCAUGAGUUC
RS 1 dot (((…….)))(((((..((((.((.(((((((((…….)))))..)))))).))))..)))))(((((……)))))………..
RS 2 seq CGGACCAACUCUGGAGAGCGGCCCCAGGCGGGCCCACCGAAGGGGCAGGCGGAUUCAAGCCGCUAUCUCUCAGGUAUCGAGGACAGAGGGGUGCAG
RS 2 dot .(.(((..((((((((((((((((…((..((((…….))))..))))……)))))..))))…………..))))).))).)..
RS 3 seq GGACGAAACUCUGGAGAGACUCGAAAGAGCACCGAAGGAGCAAGUGAGUAUAUUAUUACUCGCGAAACUCUCAGGUAAAAGGACAGAGGCGCUUUA
RS 3 dot …(((..(((….)))..)))((((.(((((…((((…(((((((……)))))))….))))..)))…………)).)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table