Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA007816 Similarity: 0.977 Similarity: 0.977 Similarity: 0.973
UTR: 5HSAA007816
Gene: ATCAY
MFE: -18.505
ENS: 0.909
Length: 113.
Predicted Ligands:
TPP - 10/20
glycine - 4/20
FMN - 4/20
 RS: URS0000ABABC3_1609975
MFE: -32.375
Ligand: glycine
Species: Clostridium sp. FS41 Glycine riboswitch
 RS: URS0000C8ABD3_1165092
MFE: -24.036
Ligand: TPP
Species: Lachnospiraceae bacterium JC7 TPP riboswitch (THI element)
 RS: URS0000C11C47_1263028
MFE: -22.020
Ligand: FMN
Species: Firmicutes bacterium CAG:536 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA007816 URS0000ABABC3_1609975 URS0000C8ABD3_1165092 URS0000C11C47_1263028
Length 113. 113. 112. 114.
Similarity - 0.977 0.977 0.973
Ensemble Norm 0.909 - - -
MFE -18.505 -32.375 -24.036 -22.020
Ligands - glycine TPP FMN
Gene ATCAY - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 4. 5.004
Length SE - 0. 1. 1.
Lev Distance - 30. 29. 33.
UBS 6. 6. 5. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 0.
ILR 2. 2. 1. 2.
H 3. 3. 3. 3.
BL 0. 1. 1. 1.
BR 1. 1. 1. 1.
UN 0.301 0.257 0.321 0.237

Sequences

Field Description
UTR seq + 25 aguaaucuagaacauucucaagccccuuuaacucagaugucaagccaccgggcaaaccccgucaauaccucccaccaaggaaugagauATGGGGACCACCGAAGCCACGCTCC
UTR dot + 25 …………………(((((((..((……)).)))…..))))…((((((…….(((……)))…….))))))……..(((…)))..
RS 1 seq AUGAUGGAUUCGGGAGAGACUGUCCGGGGGCUGGAGUGAUGAUCCGGCAGUGACUUAGGGCAGCGCCGAAGGGGAAGCGGAGAACUCUCAGGCAAAAGGACCGGAUACCGGAC
RS 1 dot ……………….((((((.(((((((((…….))))))…..))).)))))).(((..((((………..))))..)))…….((((…))))..
RS 2 seq UGAAGUAAACGGGGGUGUCGGUCAGAACCGGCUGAGAUAGGAACUGUGCGUUCCGGACCCUAUAAAACCUGAUUUGGAUCAUGCCAACGUAGGGAGUGAGCUUUAUUUAACG
RS 2 dot …………..((.((((((……)))))).)).(((((…..)))))…((((((……((((….))))…….))))))………………
RS 3 seq CAAAAUCUUCAGGGCAGAGUGAAAUUCUCGACUGGCGGUAAACUCCGCAAGCCUUCGGGCAGAACCGUUGAAAUUACGGUAGCAACAGUAAAGUCUGGAUGAAAGAAGAUUCCA
RS 3 dot …….((((……..))))…(((((((.((((……)))).))…)))))(((((((((…….)))))………….))))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table