Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA007828 Similarity: 0.986 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA007828
Gene: ATF1
MFE: -14.488
ENS: 0.951
Length: 63.
Predicted Ligands:
fluoride - 13/20
unknown - 5/20
cobalamin - 2/20
 RS: URS0000DB1040_560556
MFE: -24.178
Ligand: cobalamin
Species: Asanoa sp. 210121 Cobalamin riboswitch
 RS: URS0000DA4003_1121425
MFE: -18.535
Ligand: fluoride
Species: Desulfotomaculum australicum DSM 11792 Fluoride riboswitch
 RS: URS0000E5FA72_1801687
MFE: -18.507
Ligand: unknown
Species: Nitrospinae bacterium RIFCSPLOWO2_12_FULL_45_22 nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA007828 URS0000DB1040_560556 URS0000DA4003_1121425 URS0000E5FA72_1801687
Length 63. 62. 62. 62.
Similarity - 0.986 0.984 0.984
Ensemble Norm 0.951 - - -
MFE -14.488 -24.178 -18.535 -18.507
Ligands - cobalamin fluoride unknown
Gene ATF1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.007 3.001 3.004
Length SE - 1. 1. 1.
Lev Distance - 17. 19. 20.
UBS 4. 3. 5. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 0.
ILR 0. 0. 1. 0.
H 3. 3. 3. 3.
BL 0. 0. 0. 0.
BR 1. 0. 1. 0.
UN 0.127 0.210 0.097 0.065

Sequences

Field Description
UTR seq + 25 cagggccggcgucggucaaggucaauuggcaguugauuATGGAAGATTCCCACAAGAGTACCA
UTR dot + 25 …(((((….)))))..((((((((…))))))))..((…((((……)))).)).
RS 1 seq GGAAGCCGGUGAGAUACCGGCACGGUCGCGCCACUGUGACCACGCUUGCGUGGAAGUCAGAC
RS 1 dot ….(((((((…)))))))..((((((……))))))..((((……))))…..
RS 2 seq CUGCUCCAUGGCGAUGGAGCUCGCCUGGAAUGCCCGGAAAGGCUGAUGGCUCCUACCAAAAU
RS 2 dot ..(((((((….)))))))((((((((…..))….)))).))(((……)))….
RS 3 seq GGGUCCAGAAAUGGUUUAUAUUUCUGGAGGUUAAAUAAUAACUGAUAGUCGGGCCGCUAUCU
RS 3 dot …((((((((((…..))))))))))(((((…..)))))((((((……)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table