Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA007925 Similarity: 0.970 Similarity: 0.967 Similarity: 0.966
UTR: 5HSAA007925
Gene: ATG12
MFE: -47.445
ENS: 0.755
Length: 134.
Predicted Ligands:
cobalamin - 11/20
FMN - 3/20
Mg2+ - 2/20
 RS: URS0002315156_331679
MFE: -35.381
Ligand: Mg2+
Species: Pediococcus stilesii M-box riboswitch (ykoK leader)
 RS: URS0000C26B4B_56110
MFE: -35.559
Ligand: guanidine
Species: Oscillatoria acuminata PCC 6304 Guanidine-I riboswitch
 RS: URS0002313632_1834151
MFE: -48.842
Ligand: cobalamin
Species: Mycobacterium sp. E796 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA007925 URS0002315156_331679 URS0000C26B4B_56110 URS0002313632_1834151
Length 134. 134. 135. 133.
Similarity - 0.970 0.967 0.966
Ensemble Norm 0.755 - - -
MFE -47.445 -35.381 -35.559 -48.842
Ligands - Mg2+ guanidine cobalamin
Gene ATG12 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 24. 7.
Length SE - 0. 1. 1.
Lev Distance - 37. 32. 41.
UBS 10. 10. 11. 11.
BS 0. 0. 0. 0.
ILL 5. 4. 2. 4.
ILR 3. 5. 2. 4.
H 1. 1. 1. 1.
BL 3. 4. 6. 5.
BR 4. 3. 6. 4.
UN 0.052 0.037 0.052 0.053

Sequences

Field Description
UTR seq + 25 cgaccgagcacagacacguugcccaccgcuccucucccgaggucuguagucgcggagaaacacauguugcguuacuaacguucagaggucugcgacagcuucgauuugaATGGCGGAGGAGCCGCAGTCTGTGT
UTR dot + 25 …….((((((((..((.((((.(((((..((…(((((.((…((((((((…….((((((……))))))…….)))))))))))))))….))..))))).)).)).)).))))))))
RS 1 seq GAGGCUCCUACACGGACAAAGGCUACUGUACAGAAACGUUGUGAAACGCCAAUGUAUAGGACAGAAAAUGUCGAUUUGAAGGCAUUUUCCCAAGUAGCUAAACUGGCAGCAGUUUUACGCCGUGUAGUGCUGAA
RS 1 dot ..(((..((((((((…((((((.((((.(((….((((.((((.(((………((((…..))))……..)))..)))).))….))….))))))).))))))…)))))))).)))…
RS 2 seq AAUUAGGGCUUCUAGGGUUCCGGUUUAAAUCCCAGGGUUUAAAUGACUGGUCCGAGAGAAGCAAGCCAGCCUGAGAUUGGUUUCAGUAUCAGCAAUUAAGGUUUGGUUACACGGCGGGAAAAAAGCCCGGGAGGU
RS 2 dot …….((((((.(((((((.(((……(((((.(((((.((.((((((.((……..((((((…….)))))))).).))))))).))))).)))))……))).)))…..)))).))))))
RS 3 seq UACCGACAAGGCGCUGACGGGGCUGACAACCUUGAGGAAACCGGUGCGAAUCCGGUGCGGUCCCGCCACUGUGAUCGGGGACGGACACGUCCCGACCCGAGAGCCAGAUACUCACCGUCAGCGCUUCCUCACG
RS 3 dot ….((..((((((((((((((((……((((.((….(((.(((..((((.(.(((((.(……).))))).)..))))..))).))).))))))))))………))))))))))))..))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table