Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA008196 Similarity: 0.988 Similarity: 0.986 Similarity: 0.986
UTR: 5HSAA008196
Gene: ATL2
MFE: -8.225
ENS: 0.961
Length: 55.
Predicted Ligands:
unknown - 14/20
glutamine - 3/20
FMN - 2/20
RS: URS0000D4ACC6_1336806
MFE: -12.742
Ligand: TPP
Species: Reinekea forsetii TPP riboswitch
RS: URS000080E295_190304
MFE: -13.591
Ligand: FMN
Species: FMN RIBOSWITCH from Fusobacterium nucleatum subsp. nucleatum ATCC 25586 (PDB 2YIE, chain X)
RS: URS000080DF4D_32630
MFE: -13.591
Ligand: FMN
Species: FMN riboswitch from None (PDB 3F4G, chain X)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA008196 URS0000D4ACC6_1336806 URS000080E295_190304 URS000080DF4D_32630
Length 55. 54. 54. 54.
Similarity - 0.988 0.986 0.986
Ensemble Norm 0.961 - - -
MFE -8.225 -12.742 -13.591 -13.591
Ligands - TPP FMN FMN
Gene ATL2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.038 2.031 2.031
Length SE - 1. 1. 1.
Lev Distance - 14. 17. 17.
UBS 2. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 1.
ILR 1. 1. 1. 1.
H 1. 1. 2. 2.
BL 0. 0. 0. 0.
BR 0. 1. 0. 0.
UN 0.527 0.333 0.352 0.352

Sequences

Field Description
UTR seq + 25 aguggggaguuaauuuuaaaucgguacaagATGGATACCCAGGGTGCCTTTGATA
UTR dot + 25 ………………….(((((….(((….)))..)))))…….
RS 1 seq GCUGAGAAAAACCCGUUGAACCUGAACCAGUUUGUACUGGCGUAGGGAGCAAAG
RS 1 dot …………..(((…((((..(((((….)))))..)))).)))….
RS 2 seq GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCACGAAUCCAU
RS 2 dot ……….((..(((…….)))..)).((((……))))……..
RS 3 seq GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCACGAAAGCUU
RS 3 dot ……….((..(((…….)))..)).((((……))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table