Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA008426 Similarity: 0.974 Similarity: 0.973 Similarity: 0.972
UTR: 5HSAA008426
Gene: ATP2C2
MFE: -56.751
ENS: 0.776
Length: 114.
Predicted Ligands:
guanidine - 16/20
glycine - 3/20
Ni/Co - 1/20
RS: URS00009C752C_610332
MFE: -49.523
Ligand: glycine
Species: Thiocapsa sp. KS1 Glycine
RS: URS0000D93EED_1904968
MFE: -53.864
Ligand: guanidine
Species: Pseudonocardia sp. CNS-139 Guanidine-I riboswitch
RS: URS0000D82127_996342
MFE: -40.772
Ligand: guanidine
Species: Marivita sp. DPG-28 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA008426 URS00009C752C_610332 URS0000D93EED_1904968 URS0000D82127_996342
Length 114. 114. 113. 113.
Similarity - 0.974 0.973 0.972
Ensemble Norm 0.776 - - -
MFE -56.751 -49.523 -53.864 -40.772
Ligands - glycine guanidine guanidine
Gene ATP2C2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.009 6.009 7.028
Length SE - 0. 1. 1.
Lev Distance - 32. 33. 33.
UBS 9. 9. 7. 7.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 1.
ILR 3. 1. 3. 2.
H 3. 3. 3. 3.
BL 2. 2. 1. 2.
BR 1. 3. 0. 0.
UN 0.009 0.105 0.106 0.177

Sequences

Field Description
UTR seq + 25 ggguccggcccaggaggcuugggcgcgcgcagccaucccgggccucgccggggaccuagggacgcaggcaacgccugcgcccgcucaccATGGTCGAGGGACGCGTCTCCGAGT
UTR dot + 25 (((((((((….((((((((((.((…..))…)))))))))))))..)))))).(((.((((((…..)))))))))((((…((((((….))).)))….))))
RS 1 seq CGACUCUGGAGAGCGGUCCGGACUGCACCGACAGUCGGGACCCACCGAAGGGGCAGCAGCGACCGACGCGUUCGGUCGCCUGCAAACUCUCAGGUCUGGGACAGAGGGGCGGUG
RS 1 dot …((((((…(.(((((.(((((……))))).)))))).))..))))((((..((((((((…..))))))))))))…(((((..(((…))).)))))……
RS 2 seq GUGAGGCGCGUCUAGGGUUCCGCCCCUGCUCGGAGCGGCAGGGGGCCUGGUCCGAGAGACGCAGACGGCUCCACGCGGGAGCCGUCCCACGGCGGGACAAAAGCCCGGGAGAC
RS 2 dot …….((((((.(((..(((((((((((……))))))))…))))))…)))))).(((((((((…..)))))))))((..(((………)))..))….
RS 3 seq GAGCAGCGCAUCUAGGGUUCCGCCUCAUUCGUUGUUGUGAGGGACUGGUCCGAGAGAUGCCGCCGCUGCGGCAAAUUCCGCGCGGUACACGGCGGGGCAAAAUCCCGGGAGAG
RS 3 dot …….((((((.(((..(((((((((……..))))))…))))))…)))))).(((((.((((……)))))))))……(((((…..)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table