Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA008557 Similarity: 0.987 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA008557
Gene: ATP6AP1L
MFE: -15.473
ENS: 0.814
Length: 80.
Predicted Ligands:
SAM - 19/20
Ni/Co - 1/20

 RS: URS0000BE3BC0_864051
MFE: -23.308
Ligand: SAM
Species: Burkholderiales bacterium JOSHI_001 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000AB6A39_94624
MFE: -20.012
Ligand: SAM
Species: Bordetella petrii SAM riboswitch (alpha-proteobacteria)
 RS: URS0000AB3D3B_360910
MFE: -21.612
Ligand: SAM
Species: Bordetella avium 197N SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA008557 URS0000BE3BC0_864051 URS0000AB6A39_94624 URS0000AB3D3B_360910
Length 80. 79. 80. 81.
Similarity - 0.987 0.984 0.983
Ensemble Norm 0.814 - - -
MFE -15.473 -23.308 -20.012 -21.612
Ligands - SAM SAM SAM
Gene ATP6AP1L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.035 1.035 1.033
Length SE - 1. 0. 1.
Lev Distance - 16. 21. 21.
UBS 4. 4. 4. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 2.
ILR 2. 1. 2. 2.
H 2. 2. 2. 2.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.237 0.051 0.425 0.420

Sequences

Field Description
UTR seq + 25 ucccggcaguuuucuucugaaccuuuuugcuaauugucggaauaacuuguagaaaATGAGACTTTGGAAAGCAAGGGTTC
UTR dot + 25 ..((((((((((((….)))……….)))))))))……………..((..(((((…..)))))..))
RS 1 seq CGCCCCUCAAGCGCCGAUUUGCUCCGGAUUGCGGGCGCUUUCAACAAAUACCGCUAAAGAGGGACACGCACCCGGUGUC
RS 1 dot ….(((((((((((….(((……..))))))))))………………))))(((((…….)))))
RS 2 seq CACUUAACCGGCGCCGAUUUGCCUGAUCCGCUUGCGGGCGCCUCUAUAAAUCCAGCUAAAGAGGUCCGUAUGACCACUCC
RS 2 dot ………((((((..(..((…….))..)..))))))………………..((((…..))))…..
RS 3 seq CACAUUGUCGGCGCCGAUUUGCCUGAUCCGCUUGCGGGCGCCUCUUAUAAAUCCAGCUAAAGAGGUCUGCAAUGACCAGUC
RS 3 dot ………((((((..(..((…….))..)..))))))…………………((((……))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table