Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA008614 Similarity: 0.977 Similarity: 0.977 Similarity: 0.976
UTR: 5HSAA008614
Gene: ATP6V0B
MFE: -48.051
ENS: 0.780
Length: 110.
Predicted Ligands:
TPP - 9/20
guanidine - 7/20
methionine - 2/20
 RS: URS000231200C_1802005
MFE: -37.388
Ligand: cobalamin
Species: Pseudomonadales bacterium RIFCSPHIGHO2_02_FULL_60_43 Cobalamin riboswitch
 RS: URS0000C01C54_683316
MFE: -50.994
Ligand: TPP
Species: Frankia sp. EI5c TPP riboswitch (THI element)
 RS: URS0000C0B078_796606
MFE: -28.275
Ligand: Mg2+
Species: Bacillus methanolicus MGA3 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA008614 URS000231200C_1802005 URS0000C01C54_683316 URS0000C0B078_796606
Length 110. 110. 111. 111.
Similarity - 0.977 0.977 0.976
Ensemble Norm 0.780 - - -
MFE -48.051 -37.388 -50.994 -28.275
Ligands - cobalamin TPP Mg2+
Gene ATP6V0B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.004 8.001 7.
Length SE - 0. 1. 1.
Lev Distance - 26. 26. 28.
UBS 8. 8. 9. 8.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 3.
ILR 1. 2. 3. 2.
H 3. 2. 2. 3.
BL 2. 4. 3. 1.
BR 3. 1. 3. 1.
UN 0.145 0.209 0.117 0.162

Sequences

Field Description
UTR seq + 25 ggacagacugcgggacggacgguggacgcugggacgcguuuguagcuccggccccgccguuccgacccccgccgccgucgccgccATGACGGGGCTAGCACTGCTCTACT
UTR dot + 25 ………(((((.((((((((((..((((((..((…….)))))))).))))))).)))…)))))(.((((((……)))))).)..(((…)))…..
RS 1 seq CGCAACGGUAAGCGAGUGCGGAUUUGCCAGUAUGCCACUGUGAGCGAUCAUGGGAAGGCGGCAAAUCAAGACUUGCGAGCCCGGAGACCGGCCCCGGAGCAAAGGAACAG
RS 1 dot ………..((((((.(.((((((((…..(((.((((((….))))))…)))))))))))..)))))))..((((((.(……))))).))……….
RS 2 seq UGUGACCGACCGGGGAGCCCGCGGACGUGGGCUGAGAGGCCGGCCAGCAUGCCGCCGGCGACCCGCAGACCCGAUCGCGGUCAUGCGCGCGUGGGGAGGACCCUUCUGAUG
RS 2 dot ……….((((..(((.((((.(((((((((……)))))..)))))))).)))..))))(((((((.((((((……)))).)).)))……..))))…
RS 3 seq AAUUGGCACUAGGGGUGCCGGAGAAUGGCCGGCUGAGAUAAAGAUCCGCAAUCUUUGACCCUUUUACCUGAUCUGGUUAGUACCAGCGUAGGGAAGUGUAUUGACUUAGUC
RS 3 dot ……….((((((..((((((.((..(((((…….))..))))).))))))))))))…((((..(((((….)))))..)))).((((……))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table