Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA008643 Similarity: 0.952 Similarity: 0.951 Similarity: 0.951
UTR: 5HSAA008643
Gene: ATP6V1C1
MFE: -48.809
ENS: 0.720
Length: 174.
Predicted Ligands:
cobalamin - 15/20
lysine - 2/20
Mg2+ - 1/20
 RS: URS0002326906_1121338
MFE: -43.477
Ligand: cobalamin
Species: Clostridium tepidiprofundi DSM 19306 Cobalamin riboswitch
 RS: URS0000C4396B_1139996
MFE: -35.535
Ligand: Mg2+
Species: Enterococcus saccharolyticus subsp. saccharolyticus ATCC 43076 M-box riboswitch (ykoK leader)
 RS: URS0000DA1930_1970471
MFE: -43.507
Ligand: lysine
Species: Gilliamella sp. N-G2 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA008643 URS0002326906_1121338 URS0000C4396B_1139996 URS0000DA1930_1970471
Length 174. 173. 174. 175.
Similarity - 0.952 0.951 0.951
Ensemble Norm 0.720 - - -
MFE -48.809 -43.477 -35.535 -43.507
Ligands - cobalamin Mg2+ lysine
Gene ATP6V1C1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.001 17.010 15.004
Length SE - 1. 0. 1.
Lev Distance - 57. 58. 58.
UBS 9. 8. 8. 9.
BS 3. 5. 6. 2.
ILL 3. 1. 2. 3.
ILR 0. 1. 2. 2.
H 2. 3. 3. 2.
BL 5. 6. 4. 4.
BR 6. 5. 6. 3.
UN 0.098 0.133 0.195 0.160

Sequences

Field Description
UTR seq + 25 ggccggagcuuaggucgggaagggauggaucgcugagccgauagcguccgcuaggcugucugccucgguaccuguuacugcugcuacuuccucguuugacaccuuccuggaaucucucuugauuuuugaggaaauaccuaguaacaaacATGACTGAGTTCTGGCTTATATCTG
UTR dot + 25 ((((((((((((.((((.(…….((…(((((((.((((((………)))))).)).))))).))((((((((..(.((.(((((((…………..((((((……))))))))))))).)).)))))))))..).))))))))))))))))……..
RS 1 seq AAUUGGAUAUUUUUGAUAGGUUCAAGUGAUUGAUUAAAAGGGAAGCGAGGUGAAAGUCCUACACGGUCCCGCCACUGUGAGAGUGUAGUCGGCAUGUAUACCACUGGGAAACUGGGAAGGUUUGUCGAUGUAUAUGCUUUAGUCAGGAGACCUGCCUAUCGAUGGUACCAGUA
RS 1 dot .(((((.((((.(((((((((…..(..(((((((((.((((.(.((((…….))).).)..))))..((((…..))))……(((((((((….(((.(((((…..))))).))).))))))))))))))))))..)….))))))))).))))))))).
RS 2 seq UAAAAUAAUUGUUAGGUGAGGCUCCUAUAUGGACACAGGCUGCUGCCGCGAAAGGAUCGAGAGACCCUUAGUUUGGUAAAACAGGAAUAAUCGUUGAAGGUUAUUCAUAACGUAGCUGACAAAUACUUAUUUGUCUACGCCCUAUAGUGCUAAAGCUCAACGAUGACUAUGAAU
RS 2 dot …….((((((((.(..(((..(((((.((…….(((.((((((..((((.((….)).)))).))..))))…)))((((((((……))))))))….((((…(((((((….))))))))))))).))))).)))..).)).))))))……….
RS 3 seq AACAAAAGAAGAGGCGCAUUACUCAGGUAGAUCAUUUUAGGAACUGGAGCCGUAAAGAGAUGAUUAAUGGGGUGUAAUGCCGAGGUUUGAUUGUCAUUCCAGAAAGCAAUUGAAUCGGCUACAAGGGCUGAAUCCCUUGGGUUGUCACCCUAACAGGUGGAGCGCUUCACGGUAU
RS 3 dot ……….(((((((.(((((……(((((((((.((……..))…..)))))))))..(((((((((((.((((((…(((..(((.(((….(((……….)))….))).)))))))))))))))).)))))))…))))).)))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table