Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA008815 Similarity: 0.948 Similarity: 0.945 Similarity: 0.944
UTR: 5HSAA008815
Gene: ATP7A
MFE: -57.145
ENS: 0.849
Length: 185.
Predicted Ligands:
cobalamin - 12/20
lysine - 4/20
TPP - 2/20
 RS: URS0002323871_1121256
MFE: -55.305
Ligand: cobalamin
Species: Caldanaerobius fijiensis DSM 17918 Cobalamin riboswitch
 RS: URS0000C0AE1F_186479
MFE: -76.497
Ligand: SAM
Species: Kouleothrix aurantiaca SAM riboswitch (S box leader)
 RS: URS0000DAD0CC_1121316
MFE: -50.150
Ligand: zmp-ztp
Species: Clostridium grantii DSM 8605 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA008815 URS0002323871_1121256 URS0000C0AE1F_186479 URS0000DAD0CC_1121316
Length 185. 184. 184. 185.
Similarity - 0.948 0.945 0.944
Ensemble Norm 0.849 - - -
MFE -57.145 -55.305 -76.497 -50.150
Ligands - cobalamin SAM zmp-ztp
Gene ATP7A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 9.002 8.
Length SE - 1. 1. 0.
Lev Distance - 64. 67. 70.
UBS 14. 15. 16. 13.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 4.
ILR 2. 4. 4. 2.
H 4. 4. 4. 3.
BL 5. 4. 6. 3.
BR 5. 4. 5. 6.
UN 0.103 0.098 0.060 0.081

Sequences

Field Description
UTR seq + 25 guuguugcugccgccgccgcagccgcagcuacugugacuucuccgauugugugagcuuuguuggagccugcguacguggauuuaucgcugccacggucugcguagcuccagagguuuaaccauaggauagagaaaccaggaauguaaugaggaaaucaaaATGGATCCAAGTATGGGTGTGAATT
UTR dot + 25 (((((.(((((…….))))).)))))..(((.(..(((((..(((.((((((((((..(((((.((((((((((((………..)))))…))))))))))))))))))….)))).))).))))).))))……..(((…..)))….(.(((((….))))).)…..
RS 1 seq AACUUAAUAGCAUAAACAGGUGCCUCGAUAGUCCGAGGAGAAUAGGGAAGACGGGUGAGAUUCCCGCGCGGUCCCGCCGCUGUAUGCGAGGAGCUUUCCUCAAAAUGCCACUGGUUUUUCCCGGGAAGGCGAGGAAAUGCGAUGAUCCGCAAGCCAGAAGACCUGCCUGUUUAGGUGUCAUCUU
RS 1 dot ……….(((……)))(((((….((((.(((((((((((…..(((.(((.((((((((((((…)))))…..))).))))))).)))…….)).)))..))))))))))….)))))…((((……))))….(((.(((..((((….))))))).))).
RS 2 seq UGCUCAUCAUGAGGGGCGGAGGGACUGGCCCGACGAAGCCCGGCAACCCCCACCGAUUUAUGAUUAGCGAUUUUGGAUUUACGAUCAGGCUCUUUGCAGCCAAUCGUCAAUCGCCAAUCGUCAAUCGUAAAUGGCGGGAAGGUGCCAAUUCCUGCAGGCGCAUUGUGCGCCUGAGAGAUGAGAG
RS 2 dot ..((((…))))(((((..(((…..)))..)…))))(((.((((((.((.((((((((((.((((((…((((.(((((..((((……)))).))))).))))…)))))).)))))))))))).)))..))))))…((((.((((((((…)))))))))).))……
RS 3 seq AAAAGAUUACACGACUGGCGGAGAUAUGUGGAAUUAACCACUAUGGGAGUGUAAUUAAAUAGACAAACAACUUCAACUAUAAAUUUAUUCAAGUCCAUAACUCGCAAAAACAUGAGAUUUUGGACAUGAGUAAAUUAAGUUUAUGUAAGAUUUGUCUAUAAAUGCCGACCGCCUGGGCAACUUGU
RS 3 dot ….((((((((..((…….(((.((((……)))))))))..))))))))..(((((((((…((((((((…((((((((((.(((((.((((((……..)))).)).))))).)))))))))).)))…)).))).)))))))))…((((………))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table