Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA008901 Similarity: 0.981 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA008901
Gene: ATRNL1
MFE: -22.029
ENS: 0.953
Length: 85.
Predicted Ligands:
cyclic-di-GMP - 6/20
zmp-ztp - 4/20
homocysteine - 4/20
 RS: URS0000D96938_1805400
MFE: -16.617
Ligand: cyclic-di-GMP
Species: bacterium CG2_30_33_46 Cyclic di-GMP-II riboswitch
 RS: URS0000C3E329_1695218
MFE: -17.737
Ligand: cyclic-di-GMP
Species: Paenibacillus sp. 32O-W Cyclic di-GMP-II riboswitch
 RS: URS0000C06979_1704277
MFE: -30.970
Ligand: zmp-ztp
Species: Deinococcus sp. UR1 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA008901 URS0000D96938_1805400 URS0000C3E329_1695218 URS0000C06979_1704277
Length 85. 84. 84. 86.
Similarity - 0.981 0.981 0.981
Ensemble Norm 0.953 - - -
MFE -22.029 -16.617 -17.737 -30.970
Ligands - cyclic-di-GMP cyclic-di-GMP zmp-ztp
Gene ATRNL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15. 6. 12.005
Length SE - 1. 1. 1.
Lev Distance - 19. 23. 21.
UBS 5. 7. 6. 8.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 3.
ILR 3. 2. 1. 4.
H 1. 1. 1. 1.
BL 2. 2. 1. 2.
BR 1. 4. 1. 2.
UN 0.188 0.167 0.179 0.116

Sequences

Field Description
UTR seq + 25 aaaguaucaccuuggguaggcuugcgcaagaucaauauauccuauuggggaugggaagacATGGAGACTGGGGGCCGGGCCCGCA
UTR dot + 25 ………….((((.(((((.((…..(((…..(((((((…)))))))…..)))….)).)))))..))))…
RS 1 seq UUUAUAUAGAGAAGCGAGGAAGUGUAAUCCGUAUCUGGGCACCUGGAUUACAUGGAGCUAUUGAUGCAACCGGCUCUAUUCGUA
RS 1 dot ………….(((((..((.((…..(((((..(((.((((…..)).)).)))…)))))…..)).)).))))).
RS 2 seq AUACAUAUAGGGAGCAGAGAAGCCAGUACUUACUUUGGGCACUUUGGACUGGUGGAGCUAGUAGUGCAACCGGCCUUCUUUCAU
RS 2 dot ………….(.(((((((((…………(((((((….((((((…)))))))))))..))))).)))))))..
RS 3 seq GAGUGCGGGGGCGACUGGCGCUGAACGUGGGCUGACCACGGGGGAGCCUCCGGAAGAGUGAAUGAUCGCGCGCCUGGGUCGAACGG
RS 3 dot ……..(..(((((((((((((.(((..(((…(.(((((….))))))…)))..))).))).)))))..)))))..)..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table