Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA009015 Similarity: 0.979 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA009015
Gene: AUH_0
MFE: -33.610
ENS: 0.991
Length: 104.
Predicted Ligands:
SAM - 13/20
glycine - 4/20
guanidine - 3/20
RS: URS0000AB8FF4_258594
MFE: -38.628
Ligand: guanidine
Species: Rhodopseudomonas palustris CGA009 Guanidine-I riboswitch
RS: URS0000AB7A16_997346
MFE: -29.616
Ligand: guanidine
Species: Desmospora sp. 8437 Guanidine-I riboswitch
RS: URS0000ABBE1B_709991
MFE: -24.441
Ligand: SAM
Species: Odoribacter splanchnicus DSM 20712 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA009015 URS0000AB8FF4_258594 URS0000AB7A16_997346 URS0000ABBE1B_709991
Length 104. 105. 103. 105.
Similarity - 0.979 0.976 0.976
Ensemble Norm 0.991 - - -
MFE -33.610 -38.628 -29.616 -24.441
Ligands - guanidine guanidine SAM
Gene AUH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 11. 10.
Length SE - 1. 1. 1.
Lev Distance - 26. 27. 28.
UBS 6. 7. 7. 6.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 0.
ILR 0. 1. 2. 2.
H 3. 3. 3. 4.
BL 3. 2. 2. 2.
BR 2. 1. 0. 0.
UN 0.231 0.210 0.214 0.229

Sequences

Field Description
UTR seq + 25 ccuuaaaauuuuguuuacaacuagauuauauuuguaaauaaaauacuuugcaggugcugaccuuaaggaaagagccaaaATGGCGGCCGCGGTGGCGGCGGCAC
UTR dot + 25 …….(((((((((((((.((…..)).))))))))))))).(((((.((((….)))))))))…………..((.(((((….))))).))..
RS 1 seq AGAGUUGGUGGCUAGGGUUCCGGCCUGUUUCAGGCGCUGGUCCGAGAGCUGCCCCCCGAAGGGAGAAAUCCUUCGGACGCACGGCGGGACAAAAGCCCGGGAGAC
RS 1 dot ……(((((((.(((..(((((((……)).))))))))…)))))))..((((((((…..))))))))……..((((.(….)))))……
RS 2 seq ACGAUGGUUUUCUAGGGUUCCGCAGCGUUGCUGGACUGGUCCGAGAGAAAACACACGACUGAUGUUUCAGUUGUGCACACGGAGGGACAAAAGCCCGGGAGGA
RS 2 dot ……(((((((.(((..(((((((…))))…))))))…))))))).(((((((((….)))))))))……..(((.(….))))…….
RS 3 seq GAAUUAUAAAGAGGAGUUGAGAGACUGGGCUCUAUGAAACUCCGACAACCUCCGGAACUUUCCGAAAGGUGCCAAAACCCGGCCUGAUAACAGGAGUUAUAAUUU
RS 3 dot …………((((((.((((……))))….))))))….((((.((((….))))..))))(((…….)))…(((((….)))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table