Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA009080 Similarity: 0.966 Similarity: 0.964 Similarity: 0.961
UTR: 5HSAA009080
Gene: AURKC
MFE: -40.547
ENS: 0.719
Length: 130.
Predicted Ligands:
TPP - 10/20
guanidine - 3/20
cobalamin - 3/20
 RS: URS0000C4AEA0_908627
MFE: -46.716
Ligand: TPP
Species: Caballeronia glathei PML1(12) TPP riboswitch (THI element)
 RS: URS0000C4BEAF_1134474
MFE: -42.637
Ligand: guanidine
Species: Cellvibrio sp. BR Guanidine-I riboswitch
 RS: URS000232494F_1114943
MFE: -51.721
Ligand: cobalamin
Species: Streptomyces tsukubensis NRRL18488 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA009080 URS0000C4AEA0_908627 URS0000C4BEAF_1134474 URS000232494F_1114943
Length 130. 130. 130. 129.
Similarity - 0.966 0.964 0.961
Ensemble Norm 0.719 - - -
MFE -40.547 -46.716 -42.637 -51.721
Ligands - TPP guanidine cobalamin
Gene AURKC - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 10. 10.004
Length SE - 0. 0. 1.
Lev Distance - 41. 44. 46.
UBS 12. 10. 11. 12.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 3.
ILR 3. 2. 2. 3.
H 3. 3. 3. 2.
BL 2. 4. 4. 4.
BR 6. 5. 4. 5.
UN 0.131 0.146 0.138 0.070

Sequences

Field Description
UTR seq + 25 ggaaguaccucucugagcgguuggugccggguauaaaagaaggccgcgcagccacggcugcucacgacgccgcggaucccgaagccuguguagcagugagacaucATGCGGCGCCTCACAGTCGATGACT
UTR dot + 25 ………..(((((((((((((((((((.(………).))).))).)))..)))))))).))(((((((((((.((..((…….))..)).))..)).)))))))……((((…))))
RS 1 seq AUGACGAAACAGGGGUGCUUCGGCACGCGUCUCCCGACUAACCAGAACGGAGAAUGCGCGGCGAGGCUGAGAGAGUCCCUUUGCACCCGAUCCGGGUAAUACCGGCGAGGGAAGUUUCCGGAGACCGCCG
RS 1 dot …………….((((((.(.(((((((((…((….))…))))).)))).).))))))…((((.(.((((((((((((…)))))…….))))))).).))))(((……)))
RS 2 seq UAAAUAGAGAGCUAGGGUUCCGGUCAUUCGAUUAAUCAUCCAAUGAUGUCUGGUCCGAGAGCUUUCGACCUCUGCCGCCAGACCUUCUGGCAGGUCAUGGGUUACACGGCGGGACAAAAGCCCGGGAGAU
RS 2 dot ……(((((((.(((..(((((((((.(((…..))).)))))…)))))))…)))))))(((((.((((((((((…)))))).)).)).)))))……((((.(….)))))……
RS 3 seq GGCCACAUGUUCCAAUCCGGCUGAUACAUGCUCAUGACCAGGGGAAGCCGGUGGAAAUCCGGCGCUGACCCGCAACCGUGAGUCCGCCGGGCGGCGGACGAGCCGGACUGCCUGGGAUGGGUGCUCGAU
RS 3 dot ………(((((..((((((……(.(((…….))).))))))))))))(((.((((((.(((((((.((((..(((((((….)))))))..)).))..)))..))).).)))))).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table