Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA009170-0 Similarity: 0.991 Similarity: 0.988 Similarity: 0.987
UTR: 5HSAA009170-0
Gene: B2M
MFE: -13.566
ENS: 0.786
Length: 51.
Predicted Ligands:
unknown - 11/20
glutamine - 5/20
SAM - 4/20
 RS: URS0000D6D071_12908
MFE: -11.346
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000E60555_207745
MFE: -14.269
Ligand: unknown
Species: Variovorax sp. WDL1 nhaA-I RNA
 RS: URS0000C3C0C6_1715693
MFE: -14.998
Ligand: SAM
Species: Phaeobacter sp. CECT 7735 SAM/SAH riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA009170-0 URS0000D6D071_12908 URS0000E60555_207745 URS0000C3C0C6_1715693
Length 51. 51. 51. 49.
Similarity - 0.991 0.988 0.987
Ensemble Norm 0.786 - - -
MFE -13.566 -11.346 -14.269 -14.998
Ligands - glutamine unknown SAM
Gene B2M - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.002 6.010 4.053
Length SE - 0. 0. 4.
Lev Distance - 11. 15. 12.
UBS 3. 5. 4. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 1. 1. 2. 2.
BL 2. 3. 2. 1.
BR 2. 3. 0. 1.
UN 0.333 0.294 0.235 0.102

Sequences

Field Description
UTR seq + 25 gcacgcguuuaauauaaguggaggcgATGTCTCGCTCCGTGGCCTTAGCTG
UTR dot + 25 …………….(((.(((((.(((……..))).))))).))).
RS 1 seq AACGUUCAUCUCCCGUAUUGGAGACGCAAGUAAGCCGACUCGGAACGGAUC
RS 1 dot …………((((.((.(((.(((……)).).))).))))))…
RS 2 seq GGGUGUCACACAUGGGGUGGGGCAGGUUUGUGCGAUGGUCGGGCCGCCACG
RS 2 dot ……..(((…..))).(((.((((((.((….)))))))))))…
RS 3 seq CUGUCGUCACAACGGCUUCCUGGCGUGACGAUCAAUACCCAGUGGAGCA
RS 3 dot ….(((….)))(((((((((.(((……..))))))).))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table