Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA009448 Similarity: 0.958 Similarity: 0.956 Similarity: 0.954
UTR: 5HSAA009448
Gene: BAG2
MFE: -45.670
ENS: 0.863
Length: 148.
Predicted Ligands:
glucosamine - 7/20
cobalamin - 6/20
FMN - 2/20
 RS: URS000231DB6C_179408
MFE: -37.033
Ligand: cobalamin
Species: Oscillatoria sp. PCC 7112 Cobalamin riboswitch
 RS: URS0000DA26EC_1739315
MFE: -38.
Ligand: lysine
Species: Globicatella sp. HMSC072A10 Lysine riboswitch
 RS: URS0002330DF2_1925591
MFE: -38.032
Ligand: cobalamin
Species: Roseofilum reptotaenium AO1-A Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA009448 URS000231DB6C_179408 URS0000DA26EC_1739315 URS0002330DF2_1925591
Length 148. 147. 147. 147.
Similarity - 0.958 0.956 0.954
Ensemble Norm 0.863 - - -
MFE -45.670 -37.033 -38. -38.032
Ligands - cobalamin lysine cobalamin
Gene BAG2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.005 4. 6.002
Length SE - 1. 1. 1.
Lev Distance - 52. 57. 58.
UBS 8. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 0. 2. 0. 2.
H 5. 4. 6. 5.
BL 2. 2. 1. 2.
BR 2. 3. 2. 2.
UN 0.128 0.197 0.136 0.170

Sequences

Field Description
UTR seq + 25 ggacgggauucagcgguuccguucgucucucgccagaaagaaaaguuuuccuaaaggaauggggagguuguuacuccacuccgccuuccuucaagcugagucauuguccuccaacuugaauuaATGGCTCAGGCGAAGATCAACGCTA
UTR dot + 25 ((((((((((….)))))))))).(((.((….)).)))…………((((((.((((((…………)))).))))))))….(((((((((((……………)))))))))))(((……..)))..
RS 1 seq UGAUGUGAUUUCGCGAUCGGUUCUAGCGGGGAGCAGCCGUUAGAGGAAACGGGGAAAGUUCGGUGCAAGUCCGGCGCUGUCCCGCAACUGUAAUGAAACCCUUGUGGUUUCUAAAGUCAGAAUGCCCGCCGAUAUCUAACUCACUUU
RS 1 dot (((((((….))).)))).(((((((((…….)))))))))……((((.(((((((…….)))).))).))))(((.(((….((((((…..))))))……)))..)))………………….
RS 2 seq GUUUUUGUGCGAGGCGCGGAUGACAAGAGUACCUAAAAGGGAAAGGGGAUUUCGCCGAAACAACGCUAUUGUUGUUGGGGGCAAGCUGAAUAAGUUUGUCACUGUUCUAAUGAACCGUCCAGUUUAUUAGAAAGUGCAAUCAUUAAC
RS 2 dot ((((((((((…))))))).)))…….(((…)))((((…..)))).((..((((((……)))))).))((((((((…..))))))))(((.(((((((((((……))))))))))))))…………
RS 3 seq UAGUUGAGUCUGAAAGUCGGUUCUAGUGGGGAUCAGCCGCUAGAGGAAACGGGGAAAGUGCAGUGAGAAUCUGCCGCUGUCCCGCAACUGUGAAGGAGAAAUAUAUCACCUCCGAGUCAGAAUGCCCGCCGAUCGCUAGUCCAUGCU
RS 3 dot ………((((…))))(((((((((…….)))))))))……((((.(((((((…….)))).))).))))(((.(((….((((………..))))….)))..)))………((……..)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table