Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA009542 Similarity: 0.970 Similarity: 0.969 Similarity: 0.968
UTR: 5HSAA009542
Gene: BARD1
MFE: -23.736
ENS: 0.820
Length: 129.
Predicted Ligands:
molybdenum - 10/20
guanidine - 5/20
cobalamin - 3/20
 RS: URS0000C895AB_1173026
MFE: -43.375
Ligand: guanidine
Species: Gloeocapsa sp. PCC 7428 Guanidine-I riboswitch
 RS: URS0000AB93BA_937450
MFE: -48.579
Ligand: guanidine
Species: Oxalobacteraceae bacterium IMCC9480 Guanidine-I riboswitch
 RS: URS0000DA021F_112901
MFE: -43.789
Ligand: molybdenum
Species: Sporomusa malonica Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA009542 URS0000C895AB_1173026 URS0000AB93BA_937450 URS0000DA021F_112901
Length 129. 130. 130. 129.
Similarity - 0.970 0.969 0.968
Ensemble Norm 0.820 - - -
MFE -23.736 -43.375 -48.579 -43.789
Ligands - guanidine guanidine molybdenum
Gene BARD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.010 11.009 2.005
Length SE - 1. 1. 0.
Lev Distance - 39. 37. 42.
UBS 7. 7. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 2.
ILR 2. 2. 4. 2.
H 3. 3. 3. 3.
BL 2. 2. 1. 3.
BR 2. 2. 0. 2.
UN 0.248 0.146 0.154 0.178

Sequences

Field Description
UTR seq + 25 augucuacgaagaaaaguaugugaacaggaagaaaaguaugaaauuccugaagguccacgcagaagcaggcucaacagagaacagcugcacuugauucugaaagATGCCGGATAATCGGCAGCCGAGGA
UTR dot + 25 ……………….((((..((((((………….))))))……))))(((((.((((..((.(……..).))..)))).)))))…..(((((……)))))……..
RS 1 seq GGAAUGUGCUUCUAGGGUUCCGAUUCGGUAAAUUAACAACCGAGUGGCUGGUCCAAGAGAAGCAGCCAGCUUGAGAUUCUGAGUGCCGGAAUACGAGUUGGUCACACGGCGGGAAAAAAGCCCGGGAGAG
RS 1 dot ……(((((((.(((…(.(((((((………))))))).)….)))…)))))))(((((((((..((((((…..)))))).)))))))))…….((((…….))))……
RS 2 seq GAGCAUGGACGCUAGGGUUCCGGUGUCGUCAGUAGUAAUGGCGACAUGUCUGGUCCGAGAGCAGCCGGCCGGUGCGACAUCGUGCAAGCGAUCAGCACCGGCUACACGGAGGGAUAAAAGCCCGGGAGGC
RS 2 dot ……((..(((.(((..((((((((((((…….))))))))…)))))))…)))..))(((((((((…(((((….)))))..)))))))))…….(((…….)))…….
RS 3 seq UAAAAAAUGGCACUCCGAGCUGCAUGACCUAAGGGCAACUAUGGUCUUGCAGCCUGAACCUAGGUUCACAGGGCAGUGAAAGAAAUUUUACUGCCUCCACUACUUGGGAAGGAUGCGCUUCAUAAGUUU
RS 3 dot ………….((.(.((((((.((((..((…..))..)))).))))))).))..((((((…..(((((((((((….)))))))))))…..))))))((((……))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table