Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010113 Similarity: 0.955 Similarity: 0.952 Similarity: 0.951
UTR: 5HSAA010113
Gene: BBS9
MFE: -27.084
ENS: 0.793
Length: 171.
Predicted Ligands:
cobalamin - 7/20
FMN - 5/20
Mg2+ - 5/20
 RS: URS0002329603_1880991
MFE: -34.016
Ligand: cobalamin
Species: Oscillatoriales cyanobacterium USR001 Cobalamin riboswitch
 RS: URS0000C1735B_291594
MFE: -76.956
Ligand: FMN
Species: Micromonospora rifamycinica FMN riboswitch (RFN element)
 RS: URS0002322CDA_1198245
MFE: -79.959
Ligand: FMN
Species: Micromonospora avicenniae FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010113 URS0002329603_1880991 URS0000C1735B_291594 URS0002322CDA_1198245
Length 171. 173. 171. 171.
Similarity - 0.955 0.952 0.951
Ensemble Norm 0.793 - - -
MFE -27.084 -34.016 -76.956 -79.959
Ligands - cobalamin FMN FMN
Gene BBS9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 25. 8.
Length SE - 4. 0. 0.
Lev Distance - 51. 50. 61.
UBS 13. 15. 13. 14.
BS 0. 0. 1. 1.
ILL 2. 1. 4. 3.
ILR 2. 2. 4. 2.
H 4. 4. 4. 5.
BL 7. 6. 3. 5.
BR 4. 5. 4. 4.
UN 0.029 0.046 0.041 0.035

Sequences

Field Description
UTR seq + 25 cuuuuaacuuuuuuaaaacuuuuaaguugcauuugaauuauaaggggaucgugauuaaaaugcggauucuuguaagucugaaauuggaccuuaaaugcugaauuucugacaauauuccaggucgagauuuaauuugcauccagucuATGTCTTTATTTAAAGCCCGTGATT
UTR dot + 25 …..(((((………….)))))((((((.((((((………)))))).))))))(((….(((((((.((((.((.(((((..((((.((………)).))))..))))).)).))))))))))))))((((.(((.((((….))))..)))))))
RS 1 seq AAAUGAUUUGAACUAUGCUAUACUGCUUUAACUUGUCGUUGGGAAAGUCCGGUGCGAUUCCGGUACUGUGCCGCAACUGUAAUCAAGGAAAAAGUAAAAAGAGAAUUAUUUUCCCUUGCCUUUUAACUUUUUACCUUGUUAGUCAGAAUGCCAUUUGCAAGUUUUUCAAAGGU
RS 1 dot .(((((((((((….((……)))))))…))))))((.(.(((((((…….)))).))).).))….((((((.((((((((((((.(((((………………))))).))))))).))))))))..)))…(((.((((.((….)))))))))
RS 2 seq ACGCGCUGGCGGGGCUCGGUGAAAUUCCGAACCGGCGGUGAUCCACGCUCGACGUGGUAAGCCCGCGACCCGGACGGCUCUGCCGCCCGGUGGACCUGGUGAGAAUCCGGGGCCGACGGUGGGGGAGCGGUUCGUCCGCACCCCCGACAGUCCGGAUGGGAGACAGCGCGC
RS 2 dot .(((((((((.((..((((…….)))).)).))(((…(((((…..)))))…))).(((…(((((.(((((.(((((((((…(((((…….)))))))))..))))).))))).)))))..))).((((((……)))..)))…))))))).
RS 3 seq ACGCGCUGGCGGGACUCGGUGAAAUUCCGAACCGGCGGUGAUCCACGGCGAGACCGUGGUCAGCCCGCGACCCGGUCGGCUCUGCCGCCCGGUGGACCUGGUGUGAAUCCGGGGCCGACGGUUGGGAGCGGGACAUCCCGCCCCAGACAGUCCGGAUGGGAGACAGCGCGC
RS 3 dot .(((((((((.((..((((…….)))).)).))(.(((.((((((…..))))))))).)((.(((((..((((((((((.(((((((…..)))).)))….))))))))))))))))).(((((….)))))((((..(…..)..))))…))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table