Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010138 Similarity: 0.987 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA010138
Gene: BBX
MFE: -10.706
ENS: 0.970
Length: 66.
Predicted Ligands:
fluoride - 14/20
glutamine - 2/20
cobalamin - 2/20
 RS: URS000080E2FB_1423
MFE: -16.338
Ligand: guanine
Species: Guanine riboswitch from Bacillus subtilis (PDB 2EEU, chain A)
 RS: URS0000C1DC83_12908
MFE: -14.526
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000BF8512_504472
MFE: -9.322
Ligand: fluoride
Species: Spirosoma linguale DSM 74 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010138 URS000080E2FB_1423 URS0000C1DC83_12908 URS0000BF8512_504472
Length 66. 67. 66. 64.
Similarity - 0.987 0.987 0.987
Ensemble Norm 0.970 - - -
MFE -10.706 -16.338 -14.526 -9.322
Ligands - guanine glutamine fluoride
Gene BBX - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.006 3.004 6.001
Length SE - 1. 0. 4.
Lev Distance - 15. 17. 12.
UBS 3. 4. 3. 4.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 1.
ILR 1. 2. 0. 2.
H 1. 1. 2. 1.
BL 0. 1. 0. 2.
BR 1. 1. 0. 1.
UN 0.227 0.149 0.288 0.250

Sequences

Field Description
UTR seq + 25 uuugcuaagagguaguguuagggcaaggccuggucacaguaATGAAAGGCAGTAATAGAAATAAGG
UTR dot + 25 .(((((……..((((((((……))))).)))……….)))))…………..
RS 1 seq GGACAUAAAAUCGCGUGGAUAUGGCACGCAAGUUUCUUCCGGGCACCGUAAAUGUCCGACUAUGUCC
RS 1 dot ((((((……((.((((…(((……)))…)))).))…….))))))……….
RS 2 seq AUCGUUCAUCUUGUAAGUUUUCUAAGCUUAUUGGACGGAAGUAGACGAAAGUCGAAGGAACGCAUG
RS 2 dot .(((((((….((((((((…)))))))))))))))…..(((….)))………….
RS 3 seq CCUAUCAAAGGUGAUGGAGUUCGCCUGGAACCGCCCUCAAAAAGCUGAUAACUCCUGUAUUCGU
RS 3 dot ..(((((….(((.((.((((…..))))..)).)))……)))))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table