Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010193 Similarity: 0.982 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA010193
Gene: BCAS2
MFE: -26.101
ENS: 0.857
Length: 78.
Predicted Ligands:
cobalamin - 12/20
SAM - 4/20
zmp-ztp - 3/20
 RS: URS000232E276_12908
MFE: -15.498
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000AB9811_693977
MFE: -34.556
Ligand: cobalamin
Species: Deinococcus proteolyticus MRP Cobalamin riboswitch
 RS: URS0000DB0865_546874
MFE: -32.899
Ligand: cobalamin
Species: Friedmanniella sagamiharensis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010193 URS000232E276_12908 URS0000AB9811_693977 URS0000DB0865_546874
Length 78. 79. 78. 78.
Similarity - 0.982 0.982 0.982
Ensemble Norm 0.857 - - -
MFE -26.101 -15.498 -34.556 -32.899
Ligands - cobalamin cobalamin cobalamin
Gene BCAS2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 8.016 7.
Length SE - 1. 0. 0.
Lev Distance - 21. 21. 22.
UBS 7. 8. 9. 6.
BS 0. 0. 0. 0.
ILL 1. 2. 0. 1.
ILR 0. 1. 1. 1.
H 2. 2. 2. 2.
BL 3. 3. 4. 2.
BR 5. 4. 6. 3.
UN 0.141 0.127 0.013 0.128

Sequences

Field Description
UTR seq + 25 auaacugaguuuacgcagacgcagaaaacgcaggcaaaccugagguccucagaATGGCGGGCACAGGTTTGGTGGCTG
UTR dot + 25 ….(((.((((….)))).)))…..((.(.((((((((..(((((((…))).)))).)))))))).).))..
RS 1 seq AUACUGAAUCGUGUUGGGGAAUCAAGGUGAAAUUCCAUGGCUCUACCAGGAACCGUAAAGUCGGAGUGCCAACCAGUAU
RS 1 dot ….(((.((.(….).)).))).((((..(((((..((((.(((……..))).)))))))))..)).))…..
RS 2 seq GGGAAGUCCGGUGAGAAUCCGGCGCUGUCGCGCAGCGGUAUGUGGAGGGGCAAAGGCCCCCCCGCGAGCCCGAAUGCC
RS 2 dot (.(((((((((…….)))).))).)).)(((.((((.(((((.(((((….))))).))))).))).)..))).
RS 3 seq GGAAGCCGGUGGGACUCCGGCACGGUCGCGCCACUGUGUGGGCCAGCCCUCGACCAGAGGGUGACGCCCGAGUCAGAC
RS 3 dot …….((((.((((…….)))).)))).((((.(((((..((((((…..))))))…))))).).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table