Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010226 Similarity: 0.989 Similarity: 0.988 Similarity: 0.988
UTR: 5HSAA010226
Gene: BCKDHA
MFE: -26.146
ENS: 0.923
Length: 54.
Predicted Ligands:
unknown - 18/20
glutamine - 1/20
homocysteine - 1/20
 RS: URS0000E5FA5F_1955422
MFE: -32.906
Ligand: unknown
Species: Massilia sp. KIM nhaA-I RNA
 RS: URS0000D68C5A_12908
MFE: -8.266
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000E5FBBB_195105
MFE: -23.096
Ligand: unknown
Species: Haematobacter massiliensis sul1 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010226 URS0000E5FA5F_1955422 URS0000D68C5A_12908 URS0000E5FBBB_195105
Length 54. 53. 52. 55.
Similarity - 0.989 0.988 0.988
Ensemble Norm 0.923 - - -
MFE -26.146 -32.906 -8.266 -23.096
Ligands - unknown glutamine unknown
Gene BCKDHA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.012 5.001 5.008
Length SE - 1. 4. 1.
Lev Distance - 13. 10. 14.
UBS 3. 3. 4. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 2.
ILR 1. 0. 1. 0.
H 1. 2. 1. 1.
BL 0. 1. 2. 0.
BR 1. 1. 1. 1.
UN 0.148 0.038 0.173 0.236

Sequences

Field Description
UTR seq + 25 gccggaccgcugagugguuguuagccaagATGGCGGTAGCGATCGCTGCAGCGA
UTR dot + 25 …….((((((((((((((((((((…))))..))))))))))).))))).
RS 1 seq GGGUGUCAAGGCCGUGGUGGCCUGACAGGUUCAGCGCCGGUCGGGCCGCCGCG
RS 1 dot ..((……))((((((((((((((.(((…..))).))))))))))))))
RS 2 seq GUCGUUCAUCCUUUUUUUAUGAGGACGCAAAAGUUUACUGAAGGAACGGGAA
RS 2 dot ……..(((((((((((.(.((((……)))).))))))))..)))).
RS 3 seq CAUGGACCCGGUGCAAUCCGGGUGGCUAUUCCGGCCGCCGAUCCGCCGGACAACG
RS 3 dot …….((((((..(((..(((((((…..)))))))))).))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table