Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010379 Similarity: 0.964 Similarity: 0.960 Similarity: 0.960
UTR: 5HSAA010379
Gene: BCS1L
MFE: -49.595
ENS: 0.857
Length: 162.
Predicted Ligands:
SAM - 13/20
FMN - 4/20
Mg2+ - 1/20
 RS: URS0000C04F1B_1160718
MFE: -75.233
Ligand: SAM
Species: Streptomyces auratus AGR0001 SAM riboswitch (S box leader)
 RS: URS0000C6143F_1886670
MFE: -48.936
Ligand: SAM
Species: Paenibacillus sp. TI45-13ar SAM riboswitch (S box leader)
 RS: URS0000D9D137_249567
MFE: -74.333
Ligand: SAM
Species: Streptomyces hygroscopicus subsp. decoyicus SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010379 URS0000C04F1B_1160718 URS0000C6143F_1886670 URS0000D9D137_249567
Length 162. 162. 163. 161.
Similarity - 0.964 0.960 0.960
Ensemble Norm 0.857 - - -
MFE -49.595 -75.233 -48.936 -74.333
Ligands - SAM SAM SAM
Gene BCS1L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.005 4.004 8.006
Length SE - 0. 1. 1.
Lev Distance - 46. 51. 49.
UBS 12. 12. 11. 13.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 1.
ILR 3. 4. 3. 4.
H 4. 3. 3. 3.
BL 4. 3. 5. 4.
BR 3. 4. 2. 5.
UN 0.043 0.117 0.104 0.118

Sequences

Field Description
UTR seq + 25 gaaaggacccggggcggggccgaacgcagcuuccccaaggugcaggcgcggugaaaccaucgagacggagggccagagagucacggcgguuuucguaacaccccagggccuguaagguuugguguuucccuuucaagATGCCACTTTCAGACTTTATTCTGG
UTR dot + 25 ……(((..(((.(((((……..))))))))..)))((((((.((((((((((.(((.(((………….))).))).)))))……))))…).))))))(((((..(((((((……..))))))))))))((((……)))).
RS 1 seq CGCUCAUCCAGAGGGGCAGAGGGAUACGGCCCGUUGAAGCCCCGGCAACCCUCCAGCCGGUCUUGCCGCAAGGACGCUCGAUACGUCCCGCGCGCGAGGCUCCCGGCUAGGGAAGGUGCCAAAUCCGUCUCGUGGCGAGAUUCGUCGCGAGGAAGAUGAGGA
RS 1 dot …………(((((((.(((……))).))…)))))(((.(((.((((((((((((((((((..(((((…….))))).))).))))))…))))))..))).))))))..(((..(((((((((((…)))))))))))..)))…..
RS 2 seq UUCUUAUCGAGAGUGGUGGAGGGACUGGCCCGAUGAAACCCGGCAACCGAUUUUAGAAAAUGGAUUGCAGUGAAUGUAGCAAUCUACUUUCUAAAAUGUCAUGGUGCUAAUUCCUUCAAAAUGGCAUGUGCAGUCAAUGCAAUGUGAUUUUGGCAGAUGAGAA
RS 2 dot …((((((.(..((((……))))..)))))))…..(((.((((((((((((((.((((((((……….)))))))).))))))))))….)))))))…((..(((((((.((((.((((…..)))))))).)))))))..))……
RS 3 seq CGCUCAUCCAGAGGGGCAGAGGGAUACGGCCCGUUGAAGCCCCGGCAACCCUCCAGCCGGUCUUGCCGCCAGGACGCUGACGUCCCGCGCGCGUGAGGCUCCCGGCUAGGGAAGGUGCCAAAUCCGUCUCGUGGCGAGAUUCGUCGCGAGGAAGAUGAGGA
RS 3 dot …………(((((((.(((……))).))…)))))(((.(((.(((((((((((((((((((.(((((….))))).).))).))))))…))))))..))).))))))..(((..(((((((((((…)))))))))))..)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table