Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010470 Similarity: 0.943 Similarity: 0.935 Similarity: 0.935
UTR: 5HSAA010470
Gene: BECN1
MFE: -95.720
ENS: 0.877
Length: 210.
Predicted Ligands:
cobalamin - 16/20
TPP - 1/20
SAM - 1/20
 RS: URS0002322188_1121014
MFE: -85.191
Ligand: cobalamin
Species: Arenimonas donghaensis DSM 18148 = HO3-R19 Cobalamin riboswitch
 RS: URS0000C6769D_1035197
MFE: -55.044
Ligand: TPP
Species: Prevotella sp. oral taxon 473 str. F0040 TPP riboswitch (THI element)
 RS: URS000231CFED_351607
MFE: -86.676
Ligand: cobalamin
Species: Acidothermus cellulolyticus 11B Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010470 URS0002322188_1121014 URS0000C6769D_1035197 URS000231CFED_351607
Length 210. 210. 211. 210.
Similarity - 0.943 0.935 0.935
Ensemble Norm 0.877 - - -
MFE -95.720 -85.191 -55.044 -86.676
Ligands - cobalamin TPP cobalamin
Gene BECN1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 20. 7.003 16.
Length SE - 0. 1. 0.
Lev Distance - 67. 82. 80.
UBS 11. 13. 11. 10.
BS 4. 5. 5. 7.
ILL 2. 5. 3. 2.
ILR 1. 3. 1. 2.
H 4. 3. 5. 3.
BL 5. 5. 3. 3.
BR 5. 6. 5. 5.
UN 0.090 0.095 0.147 0.110

Sequences

Field Description
UTR seq + 25 guagcgucacguccggucucggcggaaguuuuccggcggcuaccgggaagucgcugaagacagagcgaugguaguucuggaggccucgcuccggggccgacccgaggccacagugccuccgcgguagaccggacuugggugacgggcuccgggcucccgaggugaagagcaucgggggcugagggATGGAAGGGTCTAAGACGTCCAACA
UTR dot + 25 ….((((((((((((((((.(((((…..(((((.(((((((…..((((((……..))))))))))))))))))(((((.(((.((((…..)))).)))…)).)))))))).).)))))))))….))))))..(((..(((((((((.((…..)).))))))))))))(((((………….)))))….
RS 1 seq CACUAUCUUGUGGCUGUCGGUCCCGGGUGCCACAAGUGCUUGGGUUAAUAGGGAAGCCGGUUCGAAUCCGGCACUGCCCCGCAGCGGUAUGUGGAAACGACCGCCGUCAUAGAGCACUGGGACCUGGGGUCCCGGGAAGCGACGGCCAGUAGGAGAGGCGCCCGCCUCGCGUCCACGAGUCCGAAGACCUGCCGACAGCCGCGCGAAGCA
RS 1 dot …..((.((((((((((((((((((((.((…(((((((((((…..((…(((((…….))))).)))))).((.(((((.(((….)))))))).))….))))))))).))))))))…((((…(..((((..((.((((((((….)))))…)))))..).)))..).)))))))))))))))).))….
RS 2 seq AGCAACUCUAAGGGGUGCUGGUAUAGAACAUCCGCCUAGGGACUUCAGGUUCUGAAAAGGCUGGCAUUAUAGCUAGUCUGAUUACUGAAAGUCUCGAGAUGGCUAACCAUUAGUCGUUCAUACUUGUAUGAAUAGUUCUAUACUGUGCUGAGAUUAUACCCGAAGACCUGAUCCAGAUAAUACUGGCGUAGGCAAAGAGUGCGGCGUUUUU
RS 2 dot ..((..(((..(((((((.((((((((((..(((.((.((((((((((….(((..((((((((……))))))))..)))))))).))))).)).)))((((…))))..(((((((….))))))).))))))))))))))……….)))..)))..))..((((……))))(((..(((…..))).)))…..
RS 3 seq AUGGUGUCGCCUGCGACUGGUUCGACCCCUCGGGGUCGUGCCAACAGGGAACCCGGUGUGAAUCCGGGACUGCCCCGCAGCGGUGAGCGGGAACGACCGCUGUCAUCAAGCACUGGGCCGGACGGCCUGGGAAGCGACAGCCAGUAGGUGACCGGCGAUUCGCCGGUCGGGCCCGCAAGUCCGAAGACCUGCCAGUCGCCCCGCGGACAC
RS 3 dot …(((((((..((((((((((((((((((((((((.((…………(((((…….))))))).)))))).)).))…(((((..(.(((((((((…..((.(((((((….)))))))…))))))))…..)))((((((((…)))))))))..)))))..))).))……)))))))))…))).))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table